Bridelia exaltata

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Bridelia

At a glance

Occurrence records594

Data sources8

Biological traits36

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Bridelia exaltata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility594 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF594 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Bridelia exaltata, known as the brush ironbark or scrub ironbark, is a tree of eastern Australia. It occurs in and on the margins of the drier rainforests. Also occurring by streams, often in association with the Black Bean, up to an elevation of 600 metres above sea level. It occurs from Seal Rocks, New South Wales to Maryborough, Queensland. The generic name honours Samuel Elisée Bridel-Brideri, an expert on mosses. exaltata refers to the height of the tallest trees.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length10 mm

Fruit width10 mm

Leaf length120 mm

Leaf length max120 mm

Leaf length min50 mm

Leaf mass per area93.2 g/m2

Leaf size2 292 mm²

Leaf width50 mm

Leaf width max50 mm

Leaf width min20 mm

Petiole length0.5 cm

Plant height35 m

Seed length7 mm

Seed mass26.2 mg

Seed width7 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnynnnnn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical oblanceolate obovate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)10.73 mm²/mg

Wood density680 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bridelia exaltata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896147.1 ↗539 bpAustralia

ACGT

AAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTC …

Bridelia exaltata voucher 129308726 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type594 records

Wild obs. + sensor400

Museum / vouchered136

Cultivated / captive1

Other57

Origin

Native38

Range

Area of Occupancy AOO1 548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 299≤1 km 20≤10 km 18>10 km 16

353 georeferenced · 47 without coordinates

Open the mapobservation + sensor400

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 26≤1 km 8≤10 km 47>10 km 17

98 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence136

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	39
Mount Annan, AU	38
Museo Entomologico de Leonlocation not on record	19
Armidale, AU	12
Smithfield, AU	6
Canberra, AU	6
Wollongong, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Kew, GB	1
Honolulu, US	1
Palmerston, AU	1
Adelaide, AU	1

13 institutions · 127 of 136 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Bridelia exaltata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 20.9–21.8

Seasonal swing summer↔winter14.4 °C

Max temp (day)27.2 °C 26.2–28.2

Min temp (night)15.7 °C 15.1–16.2

Precipitation53.2 mm/mo 23.1–83.3

Air humidity50.4 % 44.8–56.0

Moisture balance-81.0 mm/mo -130–-31.8

Vapour deficit1,340 Pa 1,113–1,567

Wind speed2.90 m/s 2.10–3.80

Cloud cover22.2 % 18.9–25.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)