Brickelliastrum fendleri

(A.Gray) R.M.King & H.Rob. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickelliastrum

At a glance

Occurrence records114

Data sources11

Biological traits4

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Brickelliastrum fendleri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources4 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF114 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Brickelliastrum is a North American genus of flowering plants in the tribe Eupatorieae within the family Asteraceae.King, R. M. and H. Robinson. 1972 Studies in the Eupatorieae (Asteraceae) LXXVIII. A new genus, Brickelliastrum. Phytologia 62: 63-64.24(2): 64. 1972.D.J.N.Hind & H.E.Robinson. 2007. Tribe Eupatorieae In: The Families and Genera of Vascular Plants vol.VIII. (Joachim W.Kadereit & Charles Jeffrey, volume editors. Klaus Kubitzky, general editor). Springer-Verlag. Berlin, Heidelberg. Brickelliastrum has at times been lumped with Brickellia or Steviopsis, but chromosome number (x=10) and molecular data are in agreement in showing that it is distinct from either of these.Schilling, E. E., J. L. Panero, B. S. Crozier & P. Davila. 2013. Relationships of Asanthus (Asteraceae, Eupatorieae). Systematic Botany 38: 253-258. Despite having the general appearance of Brickellia, members of Brickelliastrum have cypselae that have only 5-7 ribs (vs. 10), funnel-shaped corollas, and a style with an unenlarged, glabrous base. There is only one recognized species, Brickelliastrum fendleri. It is native to the southwestern United States (Arizona, New Mexico, and western Texas) and northern Mexico (Coahuila).Brickelliastrum in Flora of North AmericaBiota of North America Program 2014 county distribution mapTurner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272 formerly included Brickelliastrum nesomii (B.L.Turner) R.M.King & H.Rob., see Steviopsis nesomii B.L.Turner Brickelliastrum villarrealii R.M.King & H.Rob., see Steviopsis nesomii B.L.Turner

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climatedesert or dry shrubland

Climberself-supporting

Growth formForb/herb, Subshrub

03Chemical composition5 compounds

Compounds documented for Brickelliastrum fendleri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
Hyperin	present	LOTUS
Quercetin	present	LOTUS
Quercetin 3-rutinoside	present	LOTUS
Quercitrin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickelliastrum fendleri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ737023.1 ↗651 bp

ACGT

TCGAATCTTGCATGGCAAAACAACCGGTGAACATGTAACAACAAGATGGCTTGGCGGGGATTGATGCGGTTTGTTTCAAACCTCGTTAAG …

Brickelliastrum fendleri voucher Schilling 2012 TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickelliastrum fendleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 101×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — WATSON, T.J., Jr. 1973. Chromosome numbers in Compositae from the southwestern United states. Southw. Naturalist 18: 117-124.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

07Deep time~1.17 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.17 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type114 records

Wild obs. + sensor69

Museum / vouchered45

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 28≤1 km 5≤10 km 3>10 km 3

39 georeferenced · 30 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 6≤1 km 6≤10 km 4>10 km 1

17 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	18
ASUlocation not on record	8
Flagstaff, US	7
Phoenix, US	4
DOI/NPS, Colonial National Historical Parklocation not on record	3
Musee des Dinosaures d'Esperaza (Aude)location not on record	2
CASlocation not on record	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
Bloomington, US	1

9 institutions · 45 of 45 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Brickelliastrum fendleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)