Brickellia secundiflora — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records348

Data sources8

Biological traits10

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Brickellia secundiflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility348 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionLOTUS21 compounds

Occurrence & distributionGBIF348 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia secundiflora là một loài thực vật có hoa trong họ Cúc. Loài này được (Lag.) A.Gray mô tả khoa học đầu tiên năm 1852.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.922 mg

⚠ sources differ — TRY: 0.922 mg · GIFT: 0.5 mg

Seed mass max0.5 mg

Seed mass min0.5 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition21 compounds

Compounds documented for Brickellia secundiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Colensane and Clerodane diterpenoids12

Germacrane sesquiterpenoids4

Guaiane sesquiterpenoids2

Flavonols2

Acyclic monoterpenoids $ Farnesane sesquiterpenoids1

Documented compounds21 total

Compound	Amount	Source
(2R)-3-[2-[(1aS,3aR,4S,5R,7aS,7bR)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]ethyl]-2-hydroxy-2H-furan-5-one	present	LOTUS
(2S)-3-[2-[(1S,2R,4aS,5R,6R,8aR)-5,6-dihydroxy-1,2,4a,5-tetramethyl-3,4,6,7,8,8a-hexahydro-2H-naphthalen-1-yl]ethyl]-2-hydroxy-2H-furan-5-one	present	LOTUS
(3R)-5-[(1aS,3aR,4S,5R,7aS,7bR)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]-3-methylpentane-1,3-diol	present	LOTUS
(3R)-5-[(1aS,3aR,4S,5R,7aS,7bR)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]-3-methylpentanoic acid	present	LOTUS
(E)-2-[(3E,7E)-4,8,12-trimethyltrideca-3,7,11-trienyl]but-2-ene-1,4-diol	present	LOTUS
(Z)-5-[(1R,2R,4aS,7S,8aR)-7-hydroxy-1,2,4a,5-tetramethyl-2,3,4,7,8,8a-hexahydronaphthalen-1-yl]-3-methylpent-2-enoic acid	present	LOTUS
(Z)-5-[(1R,2R,4aS,8aR)-1,2,4a,5-tetramethyl-7-oxo-3,4,8,8a-tetrahydro-2H-naphthalen-1-yl]-3-methylpent-2-enoic acid	present	LOTUS
3-[2-[(1aS,2S,3aR,4S,5R,7aS,7bR)-2-hydroxy-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]ethyl]-2H-furan-5-one	present	LOTUS
3-[2-[(1aS,3aR,4S,5R,7aS,7bR)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]ethyl]-2H-furan-5-one	present	LOTUS
3-[2-[(1S,2R,4aS,5R,6R,8aR)-5,6-dihydroxy-1,2,4a,5-tetramethyl-3,4,6,7,8,8a-hexahydro-2H-naphthalen-1-yl]ethyl]-2H-furan-5-one	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia secundiflora has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM668941.1 ↗649 bp

ACGT

TCGAATCCTGCACGGCAGAACAACTTGTGAACATGTAACCACAAAATGGCTGGCGGGGATTGATCCTTTGGTTTCAACCTCGTGAAGCCT …

Brickellia secundiflora voucher Panero 1839, TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia secundiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type348 records

Wild obs. + sensor33

Museum / vouchered311

Other4

Range

Area of Occupancy AOO988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 13≤1 km 3≤10 km 2

18 georeferenced · 15 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 180≤1 km 10≤10 km 7>10 km 5

202 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence311

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	133
Mexico City, MX	43
Saint Louis, US	19
Bronx, US	15
Chapingo, MX	15
Zacatecas, MX	15
Riverside, US	9
ASUlocation not on record	9
Mexico City, MX	9
Flagstaff, US	8
Guasave, MX	5
Juriquilla, MX	5
Puebla, MX	3
Giardini Botanici Hanburylocation not on record	3
Tlalnepantla, MX	2
Kew, GB	2
Austin, US	2
Chicago, US	1
Torreón, MX	1
University of Stellenboschlocation not on record	1
Anchorage, US	1
Wuzhou, CN	1
M-VascularPlantslocation not on record	1
Edinburgh, GB	1
Mérida, MX	1
Ciudad de México, MX	1
Bloomington, US	1
MEXUlocation not on record	1

28 institutions · 308 of 311 vouchered records shown · 3 without an institution code