Brickellia scoparia — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records79

Data sources8

Biological traits12

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Brickellia scoparia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF79 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia scoparia is a Mesoamerican species of flowering plants in the family Asteraceae. It is native to Guatemala and to Mexico as far north as Nayarit.Turner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass0.5 mg

Seed mass max0.5 mg

Seed mass min0.5 mg

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition4 compounds

Compounds documented for Brickellia scoparia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols3

Flavones1

Documented compounds4 total

Compound	Amount	Source
5-hydroxy-2-(4-hydroxyphenyl)-6,7-dimethoxy-3-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
6-Hydroxykaempferol 3,6-dimethylether	present	LOTUS
6-Hydroxyluteolin 6,7,3',4'-tetramethyl ether	present	LOTUS
Santin	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia scoparia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSOM060467.1 ↗652 bp

ACGT

TCGAATCCTGCATGGCAGAACAACTTGTGAACATGTAACCACAAAATGGCTTGGCGGGGATTGATACTTTTGTTTCAAACCACGTGAAGC …

Brickellia scoparia voucher Balleza 19863 (MEXU) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia scoparia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type79 records

Wild obs. + sensor12

Museum / vouchered67

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 6≤10 km 4

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 27≤1 km 2>10 km 1

30 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	16
Durango, MX	13
Saint Louis, US	10
Ciudad de México, MX	5
Mexico City, MX	4
Tuxtla Gutiérrez, MX	4
Juriquilla, MX	3
Chapingo, MX	2
Flagstaff, US	2
Riverside, US	1
Guasave, MX	1
Mexico City, MX	1
Guatemala City, GT	1
Chicago, US	1
LDlocation not on record	1
Austin, US	1
Giardini Botanici Hanburylocation not on record	1

17 institutions · 67 of 67 vouchered records shown