Brickellia rhomboidea

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records38

Data sources7

Biological traits0

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Brickellia rhomboidea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Brickellia rhomboidea is a Mexican species of flowering plants in the family Asteraceae. It is native to the state of Sonora in northwestern Mexico, found along the shores of the Gulf of California including on offshore islands.Turner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272Greene, Edward Lee 1890. Pittonia 2(8C): 103–104Shreve, F. & I. L. Wiggins. 1964. Vegetation and Flora of the Sonoran Desert 2 vols. Stanford University Press, Stanford. Brickellia rhomboidea is a loosely branching shrub up to 150 cm (5 feet) tall.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia rhomboidea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKM668951.1 ↗644 bp

ACGT

TCGAATCCCTGCATGGCAGAACAACCTGTGAACATGTAACAACAAGATGGCTTGGCGGGTATTGATCCTTTTTGTTTCAAACCTCGTGAA …

Brickellia rhomboidea voucher Felger 85-459, TEX/LL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor12

Museum / vouchered26

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 7

9 georeferenced · 3 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 15≤10 km 1

16 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	7
Mexico City, MX	5
Hermosillo, MX	5
Bronx, US	3
ASUlocation not on record	2
La Paz, MX	1
Phoenix, US	1
New Haven, US	1
Universidad Autónoma de Occidentelocation not on record	1

9 institutions · 26 of 26 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Brickellia rhomboidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)