Brickellia peninsularis

Brandegee · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records201

Data sources9

Biological traits8

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Brickellia peninsularis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF201 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia peninsularis is a Mexican species of flowering plants in the family Asteraceae. It is native to western Mexico in the states of Baja California, Baja California Sur, and Colima.Turner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272Tropicos, Brickellia peninsularis BrandegeeBrandegee, Townshend Stith 1903. Zoë 5: 160-161Jones, Marcus Eugene 1933. Contributions to Western Botany 18: 71 as Brickellia undonis

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass0.846 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Shrub

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia peninsularis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKM668919.1 ↗651 bp

ACGT

TCGATTCCTGCACGGCAGAACAACTTGTGAACATGTAACCACAAAATGGCTTGGCGAGGATTGATCCTTTTGTTTCAACCTCGTGAAGCC …

Brickellia peninsularis voucher Levin 2104, TEX/LL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia peninsularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 92×CCDB · book-ipcn73-74 · CCDB · Cave1956

CCDB · book-ipcn73-74 — TURNER, B.L;, A.M. POWELL, & T.J. WATSON, JR. 1973. Chromosome numbers in Asteraceae. Amer. J. Bot. 60: 592-596.

CCDB · Cave1956 — Carlquist a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type201 records

Wild obs. + sensor54

Museum / vouchered147

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 15≤1 km 5≤10 km 3>10 km 4

27 georeferenced · 27 without coordinates

Open the mapobservation + sensor54

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 69≤10 km 4

73 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence147

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	35
La Paz, MX	14
Bronx, US	12
Mexico City, MX	10
Saint Louis, US	9
Austin, US	9
Riverside, US	8
Durango, MX	8
University of Stellenboschlocation not on record	7
Claremont, US	4
The University of Arizonalocation not on record	4
Kew, GB	3
Austin, US	2
Ensenada, MX	2
Tlalnepantla, MX	2
San Juan College School of Science Math & Engineeringlocation not on record	2
Flagstaff, US	1
San Francisco, US	1
Tampa, US	1
MeiseBGlocation not on record	1
Arizona State University Biocollectionslocation not on record	1
Honolulu, US	1
ASUlocation not on record	1

23 institutions · 138 of 147 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Brickellia peninsularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)