Brickellia pendula

(Schrad.) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records226

Data sources10

Biological traits7

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Brickellia pendula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionNPASS105 compounds

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia lancifolia is a Mexican species of flowering plants in the family Asteraceae. It is native to southern Mexico in the state of Oaxaca.Robinson, Benjamin Lincoln & Greenman, Jesse More 1895. American Journal of Science, ser. 4 50(296): 153Tropicos, Brickellia lancifolia B.L. Rob. & Greenm. Brickellia lancifolia is a branching shrub up to 240 cm (8 feet) tall. Its leaves partially surround the stems. The plant produces many small, nodding (hanging) flower heads with purple disc florets but no ray florets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition105 compounds

Compounds documented for Brickellia pendula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cedrane and Isocedrane sesquiterpenoids12

Arylnaphthalene and aryltetralin lignans10

Norlabdane diterpenoids9

Pimarane and Isopimarane diterpenoids7

Labdane diterpenoids $ Norlabdane diterpenoids5

Documented compounds105 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Linalyl acetate	present	NPASS
(-)-Sandaracopimaric acid	present	NPASS
(-)-Savinin	present	NPASS
(1aS,4aR,8aR)-4a,8,8-trimethyl-1,1a,4,5,6,7-hexahydrocyclopropa[j]naphthalene-2-carboxylic acid	present	NPASS
(1beta,7beta)-Cedr-8(15)-ene	present	NPASS
(1R,2R,4aR,5S,8aR)-2-hydroxy-1,4a-dimethyl-6-methylidene-5-(3-oxobutyl)-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	NPASS
(1R,2R,4aR,5S,8aR)-2-hydroxy-5-(5-hydroxy-3-methylidene-4-oxopentyl)-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	NPASS
(1R,2R,4aR,5S,8aR)-2-hydroxy-5-[(3S)-5-hydroxy-3-methylpentyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	NPASS
(1R,2R,5R,7R,8S)-2,6,6,8-tetramethyltricyclo[6.2.1.01,5]undecan-7-ol	present	NPASS
(1R,2R,5R,8S)-2,6,6,8-tetramethyltricyclo[6.2.1.01,5]undecan-7-one	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia pendula has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM668926.1 ↗651 bp

ACGT

TCGAATCCTGCACGGCAGAACAACTTGTGAACATGTAACCACAAAATGGCTTGGCGAGGATTGATTCTTGTGTTTCAACCTCGTGAAGCC …

Brickellia pendula voucher Quedensley 7057, TEX/LL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia pendula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type226 records

Wild obs. + sensor12

Museum / vouchered214

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 6≤1 km 1≤10 km 1

8 georeferenced · 4 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 114≤1 km 2≤10 km 11>10 km 1

128 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence214

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	67
Mexico City, MX	30
Austin, US	25
Saint Louis, US	18
Mexico City, MX	17
Bronx, US	13
Chapingo, MX	11
Puebla, MX	4
Guasave, MX	4
Tlalnepantla, MX	3
Ciudad de México, MX	3
Austin, US	2
ASUlocation not on record	2
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	1
MSB-2797location not on record	1
Mexico City, MX	1
Tampa, US	1
Chicago, US	1
University of Stellenboschlocation not on record	1
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	1
MEXUlocation not on record	1
Giardini Botanici Hanburylocation not on record	1

22 institutions · 208 of 214 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Brickellia pendula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)