Brickellia parvula

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records51

Data sources8

Biological traits4

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Brickellia parvula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF51 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia parvula, the Mt. Davis brickellbush, is a North American species of flowering plants in the family Asteraceae. It is native to northeastern and north-central Mexico (Chihuahua) and the southwestern United States (southern New Mexico, southern Arizona, western Texas).Turner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272Biota of North America Program 2014 county distribution map Brickellia parvula is a shrub up to 30 cm (12 inches) tall, growing from a woody caudex. It produces many small flower heads with yellow or green disc florets but no ray florets.Flora of North America, Brickellia 20parvula A.Gray

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Climberself-supporting

Growth form detailedforb

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia parvula has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKM668942.1 ↗650 bp

ACGT

TCGAATCCTGCACGGCAGAACAACTTGTGAACATGTAACCACAAAATGGCTTGGCGAGGATTGATCCTTTTGTTTCAACCTCGTGAAGCC …

Brickellia parvula voucher Correll & Johnston 24259, TEX/LL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia parvula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · eflora

CCDB · eflora

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Powell, A. M. & J. F. Weedin. 1986. Chromosome Number Reports 91. Taxon 35: 407–408.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type51 records

Wild obs. + sensor6

Museum / vouchered45

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 2≤10 km 6

9 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
EL PASO, US	22
Fort Worth, US	7
Austin, US	5
Riverside, US	3
Bronx, US	2
Flagstaff, US	2
DOI/NPS, Colonial National Historical Parklocation not on record	1
San Luis Obispo, US	1
ASUlocation not on record	1
South Kensington, GB	1

10 institutions · 45 of 45 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)