Brickellia oblongifolia

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records315

Data sources11

Biological traits7

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Brickellia oblongifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility315 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF315 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia oblongifolia, the Mojave brickellbush, is North American species of plants in the family Asteraceae. It is widespread across arid and semi-arid regions in the western United States and Canada, from British Columbia south to southern California, Arizona, and New Mexico.Biota of North America Program 2014 county distribution map Brickellia oblongifolia is a perennial herb of subshrub up to 60 cm (24 inches) tall, growing from a woody caudex. Flower heads sometime appear one at a time, sometimes in groups of several, each head cream-colored or pale yellow-green, containing disc florets but no ray florets.Flora of North America, Brickellia oblongifolia Nuttall, Trans. Amer. Philos. Soc., n. s. 7: 288. 1840. VarietiesThe Plant List, Brickellia oblongifolia Nutt. Brickellia oblongifolia var. linifolia (D.C.Eaton) B.L.Rob. - Arizona, California, Nevada, Utah, New Mexico, Colorado, Wyoming, Montana, Idaho, Washington Brickellia oblongifolia var. oblongifolia - British Columbia, Washington, Idaho, Oregon, Nevada, Montana

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass1.01 mg

Seed mass max1.01 mg

Seed mass min1.01 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Shrub, Forb/herb

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia oblongifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ737029.1 ↗645 bp

ACGT

TCGAATCTTGCATCCCAGAACAACCTGTGAACGTGTAACTACAAATTGGCTTGGTGGGGATTGGTCATTTTTGTTTCAAACCTCATGAAG …

Brickellia oblongifolia voucher Holmgren 3740 TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia oblongifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

CCDB · eflora

n 92×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.

CCDB · ipcn-api-dl — Strother, J. L. 1976a. Chromosome studies in Compositae. Amer. J. Bot. 63: 247–250.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~3.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type315 records

Wild obs. + sensor74

Museum / vouchered241

Origin

Native2

Range

Area of Occupancy AOO908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 39≤1 km 2≤10 km 4>10 km 3

48 georeferenced · 26 without coordinates

Open the mapobservation + sensor74

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 11≤1 km 29≤10 km 54>10 km 5

99 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence241

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Flagstaff, US	34
DOI/NPS, Colonial National Historical Parklocation not on record	29
WTUlocation not on record	21
Provo, US	20
Riverside, US	15
ASUlocation not on record	12
Moscow, US	10
Boise, US	9
Logan, US	9
Vancouver, CA	7
Phoenix, US	7
Henderson, US	7
EL PASO, US	6
Albuquerque, US	5
Corvallis, US	4
VALElocation not on record	4
Bangkok, TH	4
Pullman, US	3
San Luis Obispo, US	3
Caldwell, US	3
Missoula, US	3
Grand Junction, US	2
US	2
Denver, US	2
Eastern Nevada Landscape Coalitionlocation not on record	2
San Diego, US	2
Bozeman, US	2
Turku, FI	1
University of Stellenboschlocation not on record	1
Bureau of Land Managementlocation not on record	1
Oskarshamn, SE	1
Porto Alegre, BR	1
Chongqing Museumlocation not on record	1
Claremont, US	1
MAlocation not on record	1
Millersville, US	1
Jackson, US	1
Santa Barbara, US	1
Pocatello, US	1
SEINetlocation not on record	1
University of Alberta Museumslocation not on record	1

41 institutions · 241 of 241 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Brickellia oblongifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)