Brickellia microphylla

(Nutt.) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records553

Data sources9

Biological traits7

DNA specimens0

eDNA detections1

Sources9 archives

Databases and archives Brickellia microphylla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility553 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF553 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia microphylla là một loài thực vật có hoa trong họ Cúc. Loài này được (Nutt.) A.Gray mô tả khoa học đầu tiên năm 1852.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub

Woodinesswoody

03Chemical composition8 compounds

Compounds documented for Brickellia microphylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols8

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-6-methoxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-6-methoxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-6-methoxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
[5,7-Dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-6-methoxy-4-oxochromen-3-yl] hydrogen sulfate	present	LOTUS
Centaureidin	present	LOTUS
Centaurein	present	LOTUS
Jaceidin	present	LOTUS
Quercetagetin	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia microphylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKM668967.1 ↗642 bp

ACGT

TGAATCTTGCATCGCAGAACAACCTGTGAACGTGTAACTACAAATTGGCTTGGTGGGGATTGGTCATTTTTGTTTCAAACCTCATGAAGC …

Brickellia microphylla var. scabra voucher Scott et al. 1348, ASC internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia microphylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

CCDB · eflora

n 93×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Powell, A. M. & J. F. Weedin. 1986. Chromosome Number Reports 91. Taxon 35: 407–408.

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type553 records

Wild obs. + sensor288

Museum / vouchered265

Origin

Native26

Range

Area of Occupancy AOO1 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 193≤1 km 6≤10 km 5>10 km 8

212 georeferenced · 76 without coordinates

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 16≤1 km 64≤10 km 30>10 km 2

112 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence265

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	30
Riverside, US	28
Moscow, US	23
Caldwell, US	22
Phoenix, US	16
Henderson, US	13
Provo, US	10
DOI/NPS, Colonial National Historical Parklocation not on record	10
Santa Barbara, US	10
Flagstaff, US	9
Logan, US	9
San Diego, US	7
Pocatello, US	6
Angwin, US	6
Boise, US	5
Wuzhou, CN	4
Bandelier National Monumentlocation not on record	4
US	4
San Luis Obispo, US	4
ASUlocation not on record	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	4
Davis, US	3
Grand Junction, US	3
Weber State Universitylocation not on record	2
Bronx, US	2
Eastern Nevada Landscape Coalitionlocation not on record	2
Chongqing Museumlocation not on record	2
Bureau of Land Managementlocation not on record	2
Bangkok, TH	2
Austin, US	2
Mississippi State, US	1
Denver, US	1
Portland, US	1
Pittsburg, US	1
Spearfish, US	1
USFSlocation not on record	1
INFlocation not on record	1
WTUlocation not on record	1
Irvine, US	1
University of Stellenboschlocation not on record	1
Orem, US	1
Bend, US	1
Corvallis, US	1
CASlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
University of Alberta Museumslocation not on record	1

46 institutions · 264 of 265 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Brickellia microphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)