Brickellia longifolia

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records352

Data sources8

Biological traits13

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Brickellia longifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility352 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Chemical compositionLOTUS · NPASS80 compounds

Occurrence & distributionGBIF352 records

DNA & barcodingNCBIsequences

01Narrative

Brickellia longifolia, the longleaf brickellbush, is a shrub in the family Asteraceae. It is found in the Colorado Plateau and Canyonlands region of the southwestern United States, in Arizona, Utah, Nevada, and western Colorado.Canyon Country Wildflowers, Damian Fagan, 2nd ed., 2012, Morris Bush Publishing, LLC. in cooperation with Canyonlands Natural History Association,Flora of North America, Brickellia longifolia S. Watson var. longifolia Some authors consider the closely related Mojave Desert plants as a variety of B. longifoliaFlora of North America, Brickellia longifolia S. Watson var. multiflora (Kellogg) Cronquist in A. Cronquist et al., Intermount. Fl. 5: 384. 1994.Calflora taxon report, University of California, Brickellia longifolia S. Watson var. multiflora (Kellogg) Cronquist, longleaf brickellbush but others recognize it as a distinct species, B. multiflora.The Plant List, Brickellia multiflora Kellogg

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology3

Seed mass0.73 mg

Seed mass max0.73 mg

Seed mass min0.73 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry3

Leaf c466 mg/g

Leaf n14.46 mg/g

Photosynthetic pathwayC3

03Chemical composition80 compounds

Compounds documented for Brickellia longifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Piperidine alkaloids25

N-acyl amines8

Flavonols4

Cinnamic acids and derivatives3

Bisabolane sesquiterpenoids3

Documented compounds80 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,5R,6S)-2,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-5-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide	present	NPASS
(1S,2R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-3-ene-1,2-diol	present	NPASS
(1S,2S,5R,6R)-5,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-2-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide	present	NPASS
(1S,4R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol	present	NPASS
(1S,4R,5R,6S)-N-(2-methylpropyl)-6-[(E)-3-(2-methylpropylamino)-3-oxoprop-1-enyl]-4,5-dipentylcyclohex-2-ene-1-carboxamide	present	NPASS
(2E,12E)-13-(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)trideca-2,12-dienamide	present	NPASS
(2E,4E)-5-(1,3-benzodioxol-5-yl)-N-(3-methylbutyl)penta-2,4-dienamide	present	NPASS
(2E,4E)-5-(1,3-benzodioxol-5-yl)-N-[(2R)-2-methylbutyl]penta-2,4-dienamide	present	NPASS
(2E,4E)-5-(2H-1,3-benzodioxol-5-yl)-N-[(5E)-10-methylundec-5-en-1-yl]penta-2,4-dienamide	present	NPASS
(2E,4E,12Z)-N-(2-Methylpropyl)-2,4,12-octadecatrienamide	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia longifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKM668955.1 ↗647 bp

ACGT

TCGAATCCTGCATGGCAGAACAACCTGTGAACATGTAACAACAAGATGGCTTGGCGGGTATTGATCCTTTTTGTTTCAAACCTCGAGAAG …

Brickellia longifolia voucher Beatley 9722, TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type352 records

Wild obs. + sensor116

Museum / vouchered236

Origin

Native4

Range

Area of Occupancy AOO1 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 75≤1 km 7≤10 km 2>10 km 3

87 georeferenced · 29 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 16≤1 km 30≤10 km 15>10 km 1

62 georeferenced · 174 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	47
Flagstaff, US	36
Bronx, US	30
Phoenix, US	22
ASUlocation not on record	20
Provo, US	12
DOI/NPS, Colonial National Historical Parklocation not on record	8
Musee des Dinosaures d'Esperaza (Aude)location not on record	7
Claremont, US	5
Angwin, US	4
Denver, US	4
Orem, US	4
Logan, US	3
Henderson, US	3
San Diego, US	3
University of Stellenboschlocation not on record	2
Grand Junction, US	2
CASlocation not on record	2
Baltimore, US	1
Albuquerque, US	1
US	1
Irvine, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Davis, US	1
Bangkok, TH	1
Pullman, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
Boise, US	1

28 institutions · 224 of 236 vouchered records shown · 12 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)