Brickellia lemmonii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records101

Data sources9

Biological traits3

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Brickellia lemmonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Chemical compositionLOTUS19 compounds

Occurrence & distributionGBIF101 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Brickellia lemmonii, or Lemmon's brickellbush, is a North American species of flowering plants in the family Asteraceae. It is native to northeastern and north-central Mexico (Chihuahua, Coahuila) and the southwestern United States (southern New Mexico, southeastern Arizona, western Texas).Turner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272Biota of North America Program 2014 county distribution map Brickellia lemmonii is a shrub up to 50 cm (20 inches) tall. It produces many small flower heads with pale yellow-green disc florets but no ray florets.Flora of North America, Brickellia lemmonii A.Gray The species is named for John Gill Lemmon (1831–1908), husband of American botanist Sara Plummer Lemmon (1836–1923).Gray, Asa.1882 Proceedings of the American Academy of Arts and Sciences 17: 206–207 Varieties Brickellia lemmonii var. conduplicata (B.L.Rob.) B.L.Turner - New Mexico, Texas, Chihuahua, Coahuila Brickellia lemmonii var. lemmonii - Arizona, New Mexico, Texas, Chihuahua, Coahuila

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Climberself-supporting

Growth formSubshrub, Forb/herb

03Chemical composition19 compounds

Compounds documented for Brickellia lemmonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Labdane diterpenoids $ Norlabdane diterpenoids8

Labdane diterpenoids7

Germacrane sesquiterpenoids2

Humulane sesquiterpenoids1

Caryophyllane sesquiterpenoids1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	LOTUS
(1R,4aR,5S,8aR)-1,4a-dimethyl-6-methylidene-5-[2-(5-oxo-2H-furan-4-yl)ethyl]-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-1,4a-dimethyl-6-methylidene-5-[2-(5-oxo-2H-furan-3-yl)ethyl]-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-1,4a-dimethyl-6-methylidene-5-[2-(5-oxo-2H-furan-4-yl)ethyl]-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-5-(2-(3-Furanyl)ethyl)decahydro-1,4a-dimethyl-6-methylene-1-naphthalenecarboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-5-[(3R)-4-carboxy-3-methylbutyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-5-[(E)-5-hydroxy-3-(hydroxymethyl)pent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-5-[(E)-5-hydroxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-5-[(Z)-5-hydroxy-3-(hydroxymethyl)pent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(1S,4aS,5R,8aS)-5-[2-[(2S)-2-hydroxy-5-oxo-2H-furan-3-yl]ethyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia lemmonii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences5

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSKM668912.1 ↗639 bp

ACGT

TCGAATCCTGCACGGCAGAACAACTTGTGAACATGTAACCACAAAATGGCTTGGCGAGGATTGATCCTTTTGTTTCAACCTCGTGAAGCC …

Brickellia lemmonii voucher Hinton 20033, TEX/LL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor18

Museum / vouchered83

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 6≤1 km 1≤10 km 1>10 km 1

9 georeferenced · 9 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 8≤1 km 8≤10 km 3

19 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	13
EL PASO, US	10
ASUlocation not on record	10
Bronx, US	9
Phoenix, US	7
San Angelo, US	6
Austin, US	4
Flagstaff, US	3
Mexico City, MX	2
University of Stellenboschlocation not on record	2
Fort Worth, US	2
Baltimore, US	1
Chapingo, MX	1
Albuquerque, US	1
Wuzhou, CN	1
Autlán de Navarro, MX	1
Vancouver, CA	1
Claremont, US	1
San Luis Obispo, US	1
Durango, MX	1
Giardini Botanici Hanburylocation not on record	1
Linares, MX	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1

24 institutions · 81 of 83 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Brickellia lemmonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)