Brickellia frutescens — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records410

Data sources9

Biological traits8

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Brickellia frutescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF410 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Brickellia frutescens, the shrubby brickellbush, is a North American species of flowering plant in the family Asteraceae. It is native to desert regions of Arizona, southern Nevada, southern California, and Baja California.Biota of North America Program 2014 county distribution mapTurner, B. L. 1997. The Comps of Mexico: A systematic account of the family Asteraceae, vol. 1 – Eupatorieae. Phytologia Memoirs 11: i–iv, 1–272 Brickellia frutescens is a shrub up to 60 cm (2 feet) tall. It is highly branched, with many small purple flower heads.Flora of North America, Brickellia frutescens A. Gray, Proc. Amer. Acad. Arts. 17: 207. 1882.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology1

Seed mass0.713 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia frutescens has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM668891.1 ↗647 bp

ACGT

TCGAATCTTGCATCGCAGAACAACCTGTGAACATGTAACCACATATTGGCTTGGTGGGGATTGGTCATTTTTGTTTCAAACTTCATGAAG …

Brickellia frutescens voucher Van Devender 98-124, TEX/LL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcLaITS1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type410 records

Wild obs. + sensor142

Museum / vouchered268

Origin

Native2

Range

Area of Occupancy AOO720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 58≤1 km 2≤10 km 1>10 km 3

64 georeferenced · 78 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 93≤1 km 18≤10 km 17>10 km 9

137 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence268

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	104
Riverside, US	22
Claremont, US	21
ASUlocation not on record	20
Austin, US	12
Bronx, US	9
The University of Arizonalocation not on record	8
Arizona State University Biocollectionslocation not on record	7
Ensenada, MX	6
Mexico City, MX	5
Phoenix, US	5
Austin, US	5
Severin-McDaniel Insect Collectionlocation not on record	5
Calabar, NG	5
La Paz, MX	3
Santa Barbara, US	3
Davis, US	3
San Luis Obispo, US	2
Flagstaff, US	2
CASlocation not on record	2
US	2
Arcata, US	1
EL PASO, US	1
Kew, GB	1
University of Stellenboschlocation not on record	1
Los Angeles, US	1
Hermosillo, MX	1
Saint Louis, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1

30 institutions · 260 of 268 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Brickellia frutescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 21.4–21.4

Seasonal swing summer↔winter18.0 °C

Max temp (day)29.6 °C

Min temp (night)13.7 °C

Precipitation2.10 mm/mo

Air humidity43.2 %

Moisture balance-246 mm/mo

Vapour deficit1,453 Pa

Wind speed10.4 m/s

Cloud cover26.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.