Brickellia brachyphylla

(A.Gray) A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records256

Data sources9

Biological traits3

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Brickellia brachyphylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility256 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF256 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia brachyphylla, the plumed brickellbush or Hinckley's brickellbush, is a North American species of flowering plant in the family Asteraceae. It is native to the southwestern United States, in Arizona, New Mexico, Colorado, western Texas, and the Oklahoma Panhandle. There are reports that it formerly occurred in southwestern Kansas, but these populations appear to be extinct.Biota of North America Program 2014 county distribution map Brickellia brachyphylla is a shrub up to 100 cm (40 inches) tall, growing from a woody caudex. It produces many small flower heads with pale green disc florets but no ray florets.Flora of North America, Brickellia brachyphylla (A.Gray) A.Gray

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia brachyphylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKM668964.1 ↗649 bp

ACGT

TCGAATCCTGCACGGCAGAACAACTTGTGAACATGTAAACCACAAATGGCTTGGCGAGGATTGATCCTTTTGTTTCAACCTCGTGAAGCC …

Brickellia brachyphylla voucher Scott et al. 1303, ASC internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia brachyphylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-ipcn67-71 · CCDB · eflora · CCDB · book-fedorov

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

CCDB · eflora

CCDB · book-fedorov — Gaiser 1953

n 92×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Powell, A. M. & J. F. Weedin. 1986. Chromosome Number Reports 91. Taxon 35: 407–408.

CCDB · book-ipcn67-71 — GAISER, L.O. 1953. Chromosome studies in Kuhniinae (Eupatorieae). I. Brickellia. Rhodora 55: 253-267.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type256 records

Wild obs. + sensor26

Museum / vouchered230

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15≤1 km 2

17 georeferenced · 9 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 16≤1 km 44≤10 km 61>10 km 16

137 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence230

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	83
Bronx, US	29
Flagstaff, US	18
EL PASO, US	15
Wuzhou, CN	12
DOI/NPS, Colonial National Historical Parklocation not on record	12
ASUlocation not on record	8
Riverside, US	8
DOI/NPS, Greenbelt Parklocation not on record	7
Lubbock, US	6
Fort Worth, US	5
San Angelo, US	3
Provo, US	2
Pittsburg, US	2
University of Stellenboschlocation not on record	2
Moscow, US	2
Taipei, TW	2
Musee des Dinosaures d'Esperaza (Aude)location not on record	2
Denver, US	1
Pomona Collegelocation not on record	1
Chongqing Museumlocation not on record	1
Pullman, US	1
San Luis Obispo, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Mexico City, MX	1
Burlington, US	1
Phoenix, US	1
Austin, US	1
Angwin, US	1

29 institutions · 229 of 230 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)