Brickellia baccharidea

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Brickellia

At a glance

Occurrence records168

Data sources12

Biological traits7

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Brickellia baccharidea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF168 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Brickellia baccharidea, the resinleaf brickellbush, is a North American species of shrubs in the family Asteraceae. It is native to the southwestern United States (Arizona, southern New Mexico, and western Texas) and northwestern Mexico (northern Sonora, western Chihuahua).Biota of North America Program 2014 county distribution mapSEINet, Southwestern Biodiversity, Arizona Chapter, Brickellia baccharidea A. Gray includes photos and distribution map Brickellia baccharidea is a branching shrub up to 150 cm (60 inches) tall. It produces numerous cream-colored flower heads grouped into tight panicles.Flora of North America, Brickellia baccharidea A. GrayGray, Asa. 1852. Smithsonian Contributions to Knowledge 3(5): 87 description in Latin, commentary in English

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition15 compounds

Compounds documented for Brickellia baccharidea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols7

Flavones4

Simple coumarins4

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5-hydroxy-6,7-dimethoxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
6,7,8-Trimethoxycoumarin	present	NPASS
6,8-Dimethoxy-7-(3-methyl-2-butenyloxy)coumarin	present	NPASS
6-Methoxy-7-(3-methylbut-2-enoxy)chromen-2-one	present	NPASS
6-Methylscutellarein	present	LOTUS
Artemetin	present	LOTUS
Casticin	present	LOTUS
Centaureidin	present	LOTUS
Desmethoxycentaureidin	present	LOTUS
Eupatin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brickellia baccharidea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKM668957.1 ↗647 bp

ACGT

TCGAATCCTGCATGGCAGAACAACCTGTGAACATGTAAACAACAAGATGGCTTGGCGGGTATTGATCCTTTTTGTTTCAAACCTCGAGAA …

Brickellia baccharidea voucher Nash L 19444, TEX/LL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Brickellia baccharidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · eflora

CCDB · eflora

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Powell, A. M. & J. F. Weedin. 1986. Chromosome Number Reports 91. Taxon 35: 407–408.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type168 records

Wild obs. + sensor52

Museum / vouchered116

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 40≤1 km 1≤10 km 1>10 km 1

43 georeferenced · 9 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 10≤1 km 15≤10 km 11>10 km 1

37 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
EL PASO, US	40
ASUlocation not on record	17
Phoenix, US	13
Austin, US	8
Albuquerque, US	7
Riverside, US	7
Bronx, US	5
San Luis Obispo, US	3
Hermosillo, MX	3
Flagstaff, US	2
San Angelo, US	2
Austin, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Mexico City, MX	1
Northridge, US	1
Philadelphia, US	1
San Diego, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Burlington, US	1
South Kensington, GB	1

20 institutions · 116 of 116 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Brickellia baccharidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)