Breynia cernua

(Poir.) Müll.Arg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Breynia

At a glance

Occurrence records4 578

Data sources9

Biological traits38

DNA specimens8

eDNA detections8

Sources9 archives

Databases and archives Breynia cernua's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 578 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources38 traits

Occurrence & distributionGBIF4 578 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Breynia cernua grows naturally in Australia and Malesia as a shrub up to 2 m in height. Breynia cernua presumably is dependent on leafflower moths (Epicephala spp.) for its pollination, like other species of tree in the genus Breynia.Kawakita, A.; Kato, M. 2004. Obligate pollination mutualism in Breynia (Phyllanthaceae): further documentation of pollination mutualism involving Epicephala moths (Gracillariidae). American Journal of Botany. 91: 1319–1325Zhang, J.; Wang, S.; Li, H.; Hu, B.; Yang, X.; Wang, Z. 2012. "Diffuse coevolution between two Epicephala species (Gracillariidae) and two Breynia species (Phyllanthaceae). PLOS ONE. 7: e41657. The plant is known by the rather unfortunate name of fart bush.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsTRY

Size & morphology16

Fruit length4 mm

Fruit width5.75 mm

Leaf length40 mm

Leaf mass19.68 mg

Leaf mass per area25.34 g/m2

Leaf size1 357 mm²

Leaf width24.5 mm

Petiole length0.375 cm

Plant height2 m

⚠ sources differ — GIFT: 2 m · AusTraits: 4.5 m · TRY: 1.04 m

Plant height max5 m

Plant height min1 m

Seed length4.25 mm

Seed mass7.51 mg

⚠ sources differ — TRY: 7.51 mg · AusTraits: 8.22 mg · GIFT: 7.1 mg

Seed mass max7.1 mg

Seed mass min7.1 mg

Seed width2 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyyyyyyyyyy

Life spanperennial

Pollination syndromewind

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density588 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Breynia cernua has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences7

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY936650.1 ↗793 bp

ACGT

TGAGCGGTTCGCCGCCGACGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTG …

Breynia cernua 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type4 578 records

Wild obs. + sensor2 371

Museum / vouchered1 930

Cultivated / captive2

Other275

Origin

Native81

Range

Area of Occupancy AOO11 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 258≤1 km 11≤10 km 8>10 km 1

1 278 georeferenced · 1 093 without coordinates

Open the mapobservation + sensor2 371

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 176≤1 km 149≤10 km 596>10 km 99

1 020 georeferenced · 910 without coordinates

Open the institutions mapphysical evidence1 930

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	260
Canberra, AU	256
Palmerston, AU	226
Museo Entomologico de Leonlocation not on record	132
Smithfield, AU	118
Armidale, AU	60
Mount Annan, AU	59
Kew, GB	47
Kensington, AU	45
Honolulu, US	28
BISHlocation not on record	22
Adelaide, AU	14
John T. Waterhouse Herbariumlocation not on record	13
James Cook Townsvillelocation not on record	12
St. Paul, US	7
Fort Worth, US	5
Llocation not on record	5
Bronx, US	5
BGPAlocation not on record	3
Cambridge University Herbariumlocation not on record	3
Hobart, AU	3
Burlington, US	3
BMlocation not on record	2
South Kensington, GB	2
University of Stellenboschlocation not on record	2
MeiseBGlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Saint Louis, US	1
La Trobe Universitylocation not on record	1
University of the Sunshine Coastlocation not on record	1
Claremont, US	1

31 institutions · 1 338 of 1 930 vouchered records shown · 590 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Breynia cernua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 16.8–22.8

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.4 °C 20.9–25.4

Min temp (night)20.7 °C 13.1–20.7

Precipitation341 mm/mo 97.7–341

Air humidity74.2 % 62.9–74.2

Moisture balance252 mm/mo -5.20–252

Vapour deficit715 Pa 695–715

Wind speed2.10 m/s 2.10–3.20

Cloud cover49.9 % 33.4–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Breynia cernua

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry3

Other traits1

At a glance

Record type4 578 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 578 records