Brassica nigra
(L.) W.D.J.Koch · speciesAt a glance
Occurrence records56 324
Data sources16
Biological traits65
DNA specimens48
eDNA detections30
Sources16 archives
Databases and archives Brassica nigra's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility56 321 records↗
OBISOcean Biodiversity Information System3 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources65 traits
Chemical compositionLOTUS · NPASS65 compounds
Occurrence & distributionGBIF · OBIS56 324 records
Environmental DNA3 datasets · 7 countries30 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GIFT · GoaT645 Mbp
01Narrative
La moutarde noire, le chou noir, le sénevé noir ou le sènevé noir est une espèce de plantes annuelles de la famille des Brassicacées, cultivée pour ses graines servant à la préparation de condiments. L'ancien nom donné par Linné à cette plante était Sinapis nigra ; c'est sous cette appellation que l'on retrouve cette plante dans la matière médicale pseudo-scientifique homéopathique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRY
Size & morphology25
Fruit length15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 19 mm
Fruit length max20 mm
Fruit length min10 mm
Fruit width2 mm
Fruit width max3 mm
Fruit width min1.5 mm
Leaf length160 mm
Leaf length max200 mm
Leaf length min100 mm
Leaf mass253 mg
Leaf size6 917 mm²
Leaf width8 mm
Leaf width max50 mm
Leaf width min8 mm
Plant height0.912 m
⚠ sources differ — GIFT: 0.912 m · AusTraits: 1 m · LEDA: 0.93 m · TRY: 1.11 m
Plant height generative0.97 m
Plant height max2.5 m
Plant height min0.3 m
Seed length1.36 mm
Seed mass0.7 mg
⚠ sources differ — TRY: 0.7 mg · LEDA: 1.15 mg · GIFT: 1.5 mg
Seed mass max2 mg
Seed mass min0.409 mg
Seed width1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction17
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: unspecialized
Flower colouryellow
Flower length max12 mm
Flower length min7.5 mm
Flowering endSep
Flowering startJun
Life spanannual
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number3 112
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climberself-supporting
Elevation max2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formlobed
Leaf shapelanceolate
Mycorrhiza type0.000366595
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)129 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)22.1 mm²/mg
⚠ sources differ — TRY: 22.1 mm²/mg · LEDA: 26.08 mm²/mg · GIFT: 26.08 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Plant support typefree-standing
Seeds per fruit>1000
03Chemical composition65 compounds
Compounds documented for Brassica nigra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Glucosinolates8
Acyclic monoterpenoids8
Dammarane and Protostane triterpenoids6
Pinane monoterpenoids5
Cinnamic acids and derivatives4
Documented compounds65 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Caryophyllene | present | LOTUS | |
| (1R,5S)-4,6,6-trimethylbicyclo[3.1.1]hept-3-en-2-one | present | LOTUS | |
| (2E,5R)-2-hexa-2,4-diynylidene-1,6-dioxaspiro[4.4]nona-3,7-diene | present | NPASS | |
| (2E,5R,9R)-2-hexa-2,4-diynylidene-1,6-dioxaspiro[4.4]nona-3,7-dien-9-ol | present | NPASS | |
| (2R)-2-azaniumyl-3-[(S)-methylsulfinyl]propanoate | present | LOTUS | |
| (3E,6E)-alpha-Farnesene | present | LOTUS | |
| (3E,6E,8S,10R)-2,6,10-trimethyldodeca-3,6,11-triene-2,8,10-triol | present | NPASS | |
| (3R,5S,6E,9S)-3,7,11-trimethyldodeca-1,6,10-triene-3,5,9-triol | present | NPASS | |
| (3S,5R,8R,9R,10R,13R,14R,17R)-17-[(E,2S)-6-hydroxy-6-methylhept-4-en-2-yl]-4,4,8,10,14-pentamethyl-2,3,5,6,7,9,11,12,13,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS | |
| (3S,5R,8R,9R,10R,13R,14R,17S)-17-[(4E)-6-hydroxy-6-methylhepta-1,4-dien-2-yl]-4,4,8,10,14-pentamethyl-2,3,5,6,7,9,11,12,13,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | NPASS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brassica nigra has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes6
GenBank sequences9
eDNA detections30
Countries7
The DNA barcodea real sequence read deposited for this species
CGAGGGCATGTCTGCCTGGGTGTCACAAATCGTCGTCCCCCCATCCTCTCGAGGATATGGGACGGAAGCTGATCTCCCATGTGTTACCGC …
Brassica nigra isolate CPM004-7 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL3★rbcLa★ITS5★ITS2
animal barcodeplant barcodefungal barcode
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_029182 ↗ · 77 protein · 19 tRNA · 3 rRNA
rps3rpl16rpl5orf120cobcox2-1orf115borf131atp1orf109orf106corf138aatp9rpoBorf148ccmFN1orf115dorf108borf128nad1orf100orf141cox3orf106bccmFC2ccmFC1+54
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Brassica nigra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size645 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Brassica nigra0.65 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–322n range16median16mode77records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1673×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2390
CCDB · fl-europaea — LBve & LOve, 1942
CCDB · ipcn-api-dl — Wang, L., A. Li, J. Huang & R. Li. 1982. The new record of Brassica nigra (L.) Koch. Acta Bot. Yunnan. 4: 367–373.
CCDB · ipcn-api-dl — Anchev, M. E. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 596.
CCDB · ipcn-api-dl — Du, X. & Z. j. Tang. 1989. The analysis of karyotype as an aid in tracing the evolution and relations among the six species of oil-seed rape. J. SouthW. Agric. Univ. 11: 275–278.
CCDB · ipcn-api-dl — Shao, C. h. 1989. A comparative study on the karyotypes of wild rape in Xinjiang and juntus (Brassica nigra). J. Huazhong Agric. Univ. 8: 297–301.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Tang, Z. J. & X. Du. 1987. Karyotype analyses of six species of oil-seed Brassica. J. SouthW. Agric. Univ. 9(1): 59–65.
CCDB · ipcn-api-dl — Xiao, C. h. & F. x. He. 1985. A preliminary analysis of the cytological technique and the karyotypes of the three main groups of oil-seed Brassica. Oil Crops China 1985(1): 11–14.
CCDB · ipcn-api-dl — Du, W., Q. x. Chen, W. l. Chen, Z. m. Wang, X. y. Hao & H. Mo. 1993. Study on karyotypes of Xinjiang wild rape, Brassica campestris, B. nigra and B. juncea. J. August 1 Agric. Coll. 16(4): 26–31.
CCDB · ipcn-api-dl — Lan, Z. q., J. m. Xu, Y. Yang, X. f. Li, J. Huang & X. h. Lian. 1994. Application of the database of chromosome image analysis in taxonomical studies of Brassicaceae. Acta Phytotax. Sin. 32(1): 41–48.
CCDB · ipcn-api-dl — Yang, G. s., G. Röbbelen & T. d. Fu. 1994. The effect of B genome on the chromosome pairing relationship between the three homologous genomes A, B and C in Brassica. J. Huazhong Agric. Univ. 13(2): 111–117.
CCDB · ipcn-api-dl — Nakayama, S. & K. Fukui. 1997. Quantitative chromosome mapping of small plant chromosomes by improved imaging on CHIAS II. Genes Genet. Systems 72: 35–40.
CCDB · ipcn-api-dl — Mukherjee, P. 1975b. Chromosome study as an aid in tracing the evolution in Cruciferae. Cytologia 40: 727–734.
CCDB · ipcn-api-dl — Mukherjee, P. 1976. Chromosome studies of the tribe Brassiceae. Proc. Indian Sci. Congr. Assoc. 63: 117.
CCDB · ipcn-api-dl — Hijazy, H. Y. 2005. Cytogenetic and molecular reevaluation of the relationships of species belonging to the two genera Brassica and Sinapis. Cytologia 70: 447–454.
CCDB · book-ipcn75-78 — Mukherjee 1976
CCDB · book-ipcn75-78 — Mukherjee 1975b
CCDB · book-northern-plants — Frandsen 1945, 1947.
CCDB · book-ipcn73-74 — VERMA, S.C. & H. REES. 1974. Nuclear DNA and the evolution of allotetraploid Brassicae. Heredity 33: 61-68.
CCDB · book-indian_vol1 — Karpechenko, G.D. (Fedorov); Nagai, K. & Sasaoka, T. 1930a ; Manton, I. 1932; Tischler, G. 1934; U, N. 1935; Haga, T .. 1938; Sikka, S.M. 1940; Frandsen, K.J. 1943; Heiser, C.B. & Whitaker, T.W. 1948; Mizushima, U. & Katsuo, K. 1958; Robbelen, G. 1960; Curran, P.L. 1962; Easterly, N.W. 1963; Harberd, D.J. 1972 ; Mukherjee, P. 1975b, 1976 ; Kamala, T. 1978
CCDB · eflora
CCDB · book-fedorov — KapneqeHKo 1924a
CCDB · book-fedorov — Nagai, Sasaoka 1930a t
CCDB · book-fedorov — Manton 1932
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Haga 1938a
CCDB · book-fedorov — Sikka 1940
CCDB · book-fedorov — Frandsen 1943
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · brass — Ancev
CCDB · brass — Wang et al.
CCDB · brass — Tang & Du
CCDB · brass — Shao
CCDB · brass — Du et al.
CCDB · brass — Lan et al.
CCDB · brass — Xiao & He
CCDB · brass — Du & Tang
+32 more references
2n 322×CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · CromoCat 2015 — Goldblatt, P. (1981). Index to plant chromosome numbers 1975-1978 1-487
GIFT · GIFT (floras)
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yang, P., R.-q. Li & Z.-S. Zeng. (1987). Studies on the karyotype and pollen morphology of Xinjiang wild mustard and black mustard (Brassica nigra Koch). Journal of Wuhan University : Natural Sciences Edition (2): 88-92
2n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kumar, S. (1984). Effect of radiation on heterochromatin phenotype in Brassica Proceedings of the Indian Science Congress Association 71(3-VI): 90-91
n 827×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 691-719. Diosdado, J. C. & al.Lagascalia17(1): 173-184(1993).
CCDB · ipcn-api-dl — Lan, Y. z. 1986. Chromosome numbers of Brassicaceae (Cruciferae) in China. Acta Phytotax. Sin. 24: 268–272.
CCDB · ipcn-api-dl — Wang, L., A. Li, J. Huang & R. Li. 1982. The new record of Brassica nigra (L.) Koch. Acta Bot. Yunnan. 4: 367–373.
CCDB · ipcn-api-dl — Hosaka, K., S. F. Kianian, J. M. McGrath & C. F. Quiros. 1990. Development and chromosomal localization of genome-specific DNA markers of Brassica and the evolution of amphidiploids and n = 9 diploid species. Genome 33: 131–142.
CCDB · ipcn-api-dl — Diosdado, J. C., C. Santa-Bárbara, J. Vioque, R. Juan & J. Pastor. 1993. Números cromosomáticos para la flora Española. 691--719. Lagascalia 17: 173–184.
CCDB · book-ipcn72 — HARBERD, D.J. 1972. A contribution to the cytotaxonomy of Brassica (Cruciferael and its allies. Bot. J. Linn. Soc. 65: 1-23.
CCDB · brass — Takahata & Hinata
CCDB · brass — Wang et al.
CCDB · brass — Lan
CCDB · brass — Lan et al.
CCDB · brass — Harberd
CCDB · brass — Tischler
CCDB · brass — Sikka
CCDB · brass — U
CCDB · brass — Rbbelen
CCDB · brass — Diosdado et al.
CCDB · brass — Easterly
CCDB · Cave1963 — Easterly 1963
CCDB · CromoCat 2015 — Diosdado, J. C., Santa-Barbara, C. Vioque, J., Juan, R. & Pastor, J. (1993a). Números cromosómicos para la flora española. 691-719. Lagascalia 17(1): 173-184.
CCDB · CromoCat 2015 — Yang-Zhen, L. (1986). Chromosome numbers of Brassicaceae (Cruciferae) in China. Acta Phytotax. Sinica 24: 268-272.
CCDB · CromoCat 2015 — Hosaka, K., Kianian, S. F., McGrath, J. M. & Quiros, C. F. (1990). Development and chromosomal localization of genome-specific DNA markers of Brassica and the evolution of amphidiploids and n = 9 diploid species Genome 33: 131-142
CCDB · CromoCat 2015 — Lan, Y.-Z. (1986). Chromosome numbers of Brassicaceae (Cruciferae) in China Acta Phytotaxonomica Sinica 24: 268-272
CCDB · CromoCat 2015 — Wang, L., A. Li, J. Huang & R. Li (1982). The new record of Brassica nigra (L.) Koch. Acta Bot. Yunnan. 4: 367–373
n 164×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · brass +1
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · brass — Sharma
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.5% BUSCO
08Occurrence & distribution
Record type56 324 records
Wild obs. + sensor47 090
Museum / vouchered3 564
Cultivated / captive32
Other5 638
Origin
Native8 679
Introduced256
Range
Area of Occupancy AOO75 100 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy24% within 1 km
≤100 m 2 655≤1 km 7 493≤10 km 32 381>10 km 230
42 759 georeferenced · 4 331 without coordinates
Open the mapobservation + sensor47 090
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 283≤1 km 561≤10 km 722>10 km 117
1 683 georeferenced · 1 881 without coordinates
Open the institutions mapphysical evidence3 564
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤1 km 1≤10 km 9>10 km 11
21 georeferenced · 11 without coordinates
Open the mapnot free-living32
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions183 of 292 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 205 |
| South Kensington, GB | 130 |
| San Diego, US | 126 |
| Philadelphia, US | 102 |
| MeiseBGlocation not on record | 101 |
| BFLlocation not on record | 96 |
| Madison, US | 73 |
| Claremont, US | 67 |
| Chongqing Museumlocation not on record | 66 |
| DBF-NHMDlocation not on record | 62 |
| Riverside, US | 59 |
| Uppsala, SE | 54 |
| Santa Barbara, US | 54 |
| SLU Artdatabankenlocation not on record | 49 |
| San Luis Obispo, US | 47 |
| Uniwersytet Wrocławskilocation not on record | 47 |
| Canadian Department of Agriculturelocation not on record | 41 |
| DAOlocation not on record | 40 |
| Adam Mickiewicz University in Poznańlocation not on record | 39 |
| Bloomington, US | 39 |
| University of New Hampshirelocation not on record | 36 |
| Oskarshamn, SE | 35 |
| Saint Louis, US | 34 |
| St. Paul, US | 33 |
| Zürich, CH | 31 |
| US | 30 |
| Pullman, US | 30 |
| Irvine, US | 30 |
| Durango, MX | 30 |
| Bern, CH | 30 |
| Corvallis, US | 29 |
| Québec, CA | 29 |
| Phoenix, US | 28 |
| Uniwersytet Jagiellońskilocation not on record | 27 |
| Davis, US | 26 |
| Burlington, US | 25 |
| ASUlocation not on record | 24 |
| Wuzhou, CN | 24 |
| Allentown, US | 22 |
| Mexico City, MX | 22 |
| Berlin, DE | 20 |
| Flagstaff, US | 20 |
| Provo, US | 19 |
| Rishon Le Zion, IL | 19 |
| Guasave, MX | 18 |
| Christchurch, NZ | 18 |
| Baroda, IN | 18 |
| Acadia Universitylocation not on record | 17 |
| Mexico City, MX | 17 |
| WTUlocation not on record | 17 |
| Salzburg, AT | 16 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 16 |
| CASlocation not on record | 16 |
| MAlocation not on record | 15 |
| Entomological Society of Latvialocation not on record | 15 |
| Turlock, US | 14 |
| Chicago, US | 14 |
| Victoria, CA | 14 |
| Görlitz, DE | 13 |
| Montréal, CA | 13 |
| Ann Arbor, US | 12 |
| New Haven, US | 12 |
| Kew, GB | 12 |
| Logan, US | 12 |
| Museo Entomologico de Leonlocation not on record | 11 |
| Los Angeles, US | 11 |
| BClocation not on record | 11 |
| Université Lavallocation not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| BDBClocation not on record | 11 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 11 |
| College of the Atlantic, Museumlocation not on record | 10 |
| McWane Science Centerlocation not on record | 10 |
| Bangkok, TH | 9 |
| Denver, US | 9 |
| Tampa, US | 9 |
| Arcata, US | 9 |
| Spearfish, US | 8 |
| Zapopan, MX | 8 |
| University of Stellenboschlocation not on record | 8 |
| Chicago, US | 8 |
| Davenport, US | 8 |
| ESP003location not on record | 8 |
| Hermosillo, MX | 8 |
| Angwin, US | 8 |
| Auckland, NZ | 7 |
| Tilburg, NL | 7 |
| Austin, US | 7 |
| Northridge, US | 7 |
| Staten Island, US | 7 |
| BAYLUlocation not on record | 7 |
| Zürich, CH | 7 |
| Frankfurt am Main | 7 |
| Ensenada, MX | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Mlocation not on record | 6 |
| Henderson, US | 6 |
| Long Beach, US | 6 |
| Culiacán, MX | 6 |
| Pocatello, US | 6 |
| Weber State Universitylocation not on record | 6 |
| BRNUlocation not on record | 6 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Vitoria, ES | 6 |
| Moscow, US | 5 |
| Portland, US | 5 |
| San Francisco, US | 5 |
| Emporia, US | 5 |
| Saint John, CA | 5 |
| Tartu, EE | 5 |
| Springfield, US | 5 |
| Bourges, FR | 5 |
| Juriquilla, MX | 5 |
| Sagamihara, JP | 5 |
| Philadelphia, US | 5 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| Wlocation not on record | 5 |
| San Isidro, AR | 5 |
| Fort Worth, US | 5 |
| CICYTEXlocation not on record | 5 |
| Tacoma, US | 5 |
| Hudson, US | 5 |
| GJOlocation not on record | 5 |
| Kensington, AU | 5 |
| Pamplona, ES | 5 |
| Vancouver, CA | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Ciudad Autónoma de Buenos Aires, AR | 5 |
| Provincia di Livornolocation not on record | 5 |
| Toronto, CA | 5 |
| Córdoba, AR | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Green Bay, US | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Hobart, AU | 4 |
| Universidad de Antioquia (UdeA)location not on record | 4 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 4 |
| Paris, FR | 4 |
| Bozeman, US | 4 |
| College Park, US | 4 |
| Adelaide, AU | 4 |
| BISHlocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Barcelona, ES | 4 |
| Santa Cruz, US | 4 |
| Granada, ES | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| San Sebastián, ES | 3 |
| POL003location not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| CJBNlocation not on record | 3 |
| Porrentruy, CH | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Morgantown, US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Madrid, ES | 3 |
| Ciudad de México, MX | 3 |
| Albuquerque, US | 3 |
| Honolulu, US | 3 |
| GZUlocation not on record | 3 |
| EL PASO, US | 3 |
| Fredericton Stock Culture Collectionlocation not on record | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| Chicago, US | 3 |
| Minia, EG | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| DASSHlocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Catalina Island Conservancylocation not on record | 3 |
| Museo Achille Folettolocation not on record | 2 |
| Macomb, US | 2 |
| Castelar, AR | 2 |
| UChlocation not on record | 2 |
| Little Rock, US | 2 |
| Torreón, MX | 2 |
| Orem, US | 2 |
| Hamilton, US | 2 |
| Sevilla, ES | 2 |
| Pittsburg, US | 2 |
| Zacatecas, MX | 2 |
| Miami, US | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Mexico City, MX | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| WNNUlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Badajoz, ES | 2 |
| ROM007location not on record | 2 |
| Puebla, MX | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Chapingo, MX | 2 |
| CJBGlocation not on record | 2 |
| Canberra, AU | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Nijmegen, NL | 2 |
| Mississippi State, US | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Ashland, US | 2 |
| Cheney, US | 2 |
| Bratislava, SK | 2 |
| Boise, US | 2 |
| Columbia, US | 2 |
| Tokushima, JP | 2 |
| Dover, US | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Dresden, DE | 2 |
| Xiamen, CN | 2 |
| Washington, US | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| Parkville, AU | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Brisbane, AU | 2 |
| Chadron, US | 2 |
| Jaén, ES | 2 |
| Brookings, US | 1 |
| Whitewater, US | 1 |
| KNFHClocation not on record | 1 |
| OLAlocation not on record | 1 |
| Fredericksburg, US | 1 |
| Loja, EC | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Mount Annan, AU | 1 |
| Jyväskylä, FI | 1 |
| Pretoria, ZA | 1 |
| IDElocation not on record | 1 |
| Pondicherry, IN | 1 |
| NO DISPONIBLElocation not on record | 1 |
| INBIOlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Shinshu Universitylocation not on record | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| Brussel, BE | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Odawara, JP | 1 |
| US | 1 |
| Lausanne, CH | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Norfolk, US | 1 |
| Lubbock, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Tallinn, EE | 1 |
| Karlsruhe, DE | 1 |
| San Jose, US | 1 |
| SIHUlocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| La Paz, BO | 1 |
| Springfield, US | 1 |
| Valparaíso, CL | 1 |
| PRClocation not on record | 1 |
| La Paz, MX | 1 |
| H-AkrKGlocation not on record | 1 |
| Toluca, MX | 1 |
| Boumlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Edmonton, CA | 1 |
| FUNEDlocation not on record | 1 |
| Córdoba, ES | 1 |
| Xining, CN | 1 |
| Alicante, ES | 1 |
| SMMUlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Millersville, US | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Guatemala City, GT | 1 |
| Sucre, BO | 1 |
| Dehra Dun, IN | 1 |
| H-Dunkellocation not on record | 1 |
| SZUlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| Morelia, MX | 1 |
| Bothell, US | 1 |
| Missoula, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| GB | 1 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 1 |
| Waverly, US | 1 |
| Teresina, BR | 1 |
| Montecillo, Texcoco, MX | 1 |
| Anchorage, US | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Oswego, US | 1 |
| Fullerton, US | 1 |
| Williamsburg, US | 1 |
| GMBAlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
292 institutions · 3 199 of 3 564 vouchered records shown · 353 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA30 detections
Where the DNA of Brassica nigra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys3
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map7 countries0
GreenhouseDisturbed vacant lot and adjoining fence lin…Wet area of lush vegetation with Solidago an…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 13.2–17.6
Seasonal swing summer↔winter15.3 °C
Max temp (day)19.4 °C 16.1–21.0
Min temp (night)12.5 °C 8.70–15.1
Precipitation71.5 mm/mo 49.3–98.5
Air humidity60.3 % 57.7–65.6
Moisture balance-28.0 mm/mo -50.2–-3.30
Vapour deficit695 Pa 577–808
Wind speed3.50 m/s 2.60–5.50
Cloud cover41.2 % 36.6–50.5
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.