Brassica napus
speciesAt a glance
Occurrence records63 269
Data sources18
Biological traits141
DNA specimens88
eDNA detections126
Sources18 archives
Databases and archives Brassica napus's data was compiled from.
WikipediaWikimedia Foundation21 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility63 269 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI126 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics88 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources141 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS6 357 compounds
Occurrence & distributionGBIF63 269 records
Environmental DNA3 datasets · 10 countries126 detections
DNA & barcodingBOLD · NCBI88 specimens
Genome at a glanceCCDB · GoaT · NCBI597 Mbp
01Narrative
Rapeseed (Brassica napus subsp. napus), also known as rape, or oilseed rape, is a bright-yellow flowering member of the family Brassicaceae (mustard or cabbage family), cultivated mainly for its oil-rich seed, which naturally contains appreciable amounts of erucic acid. Canola are a group of rapeseed cultivars which were bred to have very low levels of erucic acid and are especially prized for use as human and animal food. Rapeseed is the third-largest source of vegetable oil and the second-largest source of protein meal in the world. Rapeseed fields
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology24
Fruit length65 mm
Fruit length max80 mm
Fruit length min40 mm
Fruit width4 mm
Leaf length150 mm
Leaf length max250 mm
Leaf length min50 mm
Leaf width100 mm
Leaf width max60 mm
Leaf width min20 mm
Plant height0.854 m
⚠ sources differ — GIFT: 0.854 m · LEDA: 0.963 m · USDA: 1.22 m · TRY: 0.383 m
Plant height generative1.2 m
Plant height max1.5 m
Plant height min0.3 m
Seed length2.09 mm
Seed mass3.31 mg
⚠ sources differ — TRY: 3.31 mg · LEDA: 4.39 mg · GIFT: 3.48 mg
Seed mass max5.22 mg
Seed mass min1.4 mg
Seed volume4.2 mm³
Seed volume max4.2 mm³
Seed volume min4.2 mm³
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction38
After harvest regrowth rateSlow
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colouryellow
Flower conspicuousYes
Flower length max15 mm
Flower length min10 mm
Flowering endAug
Flowering startApr
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDARapid
Life formannual or biennial
Life spanannual
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number180 472
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodFall, Winter and Spring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureCoarse
Fruit colourblack
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · TRY: crop
Growth form USDASingle Crown
Habitat GIFTopen roadsides
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min130 days
Leaf c406 mg/g
Leaf dry-matter content (LDMC)132 mg/g
Leaf n39.74 mg/g
Leaf p3.5 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min40 in
Protein potentialMedium
Salinity toleranceNone
Seed longevity index0.5
Shade toleranceHigh
Soil pH max7.2 pH
Soil pH min6 pH
Specific leaf area (SLA)20.46 mm²/mg
⚠ sources differ — TRY: 20.46 mm²/mg · LEDA: 24.8 mm²/mg · GIFT: 24.81 mm²/mg
Temperature min17 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound156 960 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typeseed
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Seeds per fruit>1000
03Chemical composition6 357 compounds
Compounds documented for Brassica napus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids140
Glycerophospholipids57
Cinnamic acids and derivatives56
Glucosinolates45
Unsaturated fatty acids41
Documented compounds6 357 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sugars | 6,020 mg/100g | FooDB | |
| Sucrose | 4,100 mg/100 g | FooDB | |
| AVENASTEROL | 900 mg/100g | FoodAtlas | |
| delta7-stigmasterol | 900 mg/100g | FoodAtlas | |
| Potassium | 392 mg/100g | FooDB |
05DNA & barcoding88 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brassica napus has left across the world's sequence archives.
At a glance
DNA specimens88
Marker genes11
GenBank sequences10
eDNA detections126
Countries10
The DNA barcodea real sequence read deposited for this species
TTGTCGTACCCTGGAAACAGAACGACCTGAGAACGATGAAACATCACTCTCGGTAGGCCGGTTTCTTACTGTGCCTGCTGATTCCGTGGT …
Brassica napus strain SH1629757.08FU internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcL-like★rbcLa★ITS7★ITS1★ITS2atp6COIICOXIII
animal barcodeplant barcodefungal barcodemitochondrial
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_008285 ↗ · 79 protein · 17 tRNA · 3 rRNA
nad7orf120orf115aorf114orfBorf124orf286orf113aorf106aorf110orf100aorf101aorf123orf113bnad5nad9ccmFN2atp6orf25nad4Lorf101borf222orf188rps7orf119orf125+56
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Brassica napus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size596 580 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Brassica napus0.60 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 38 n = 19
Ploidypolyploid inferred
Chromosome records10–382n range38median38mode82records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3860×GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl · CCDB · nw-europe-fl +12
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2380
CCDB · fl-europaea — Bijok, 1959
CCDB · ipcn-api-dl — Li, R. q. 1989. Studies on Karyotypes of Vegetables in China
CCDB · ipcn-api-dl — Du, X. & Z. j. Tang. 1989. The analysis of karyotype as an aid in tracing the evolution and relations among the six species of oil-seed rape. J. SouthW. Agric. Univ. 11: 275–278.
CCDB · ipcn-api-dl — Olin-Fatih, M. & W. K. Heneen. 1992. C-Banded karyotypes of Brassica campestris, B. oleracea, and B. napus. Genome 35: 583–589.
CCDB · ipcn-api-dl — Tang, Z. J. & X. Du. 1987. Karyotype analyses of six species of oil-seed Brassica. J. SouthW. Agric. Univ. 9(1): 59–65.
CCDB · ipcn-api-dl — Xiao, C. h. & F. x. He. 1985. A preliminary analysis of the cytological technique and the karyotypes of the three main groups of oil-seed Brassica. Oil Crops China 1985(1): 11–14.
CCDB · ipcn-api-dl — Lan, Z. q., J. m. Xu, Y. Yang, X. f. Li, J. Huang & X. h. Lian. 1994. Application of the database of chromosome image analysis in taxonomical studies of Brassicaceae. Acta Phytotax. Sin. 32(1): 41–48.
CCDB · ipcn-api-dl — Yang, G. s., G. Röbbelen & T. d. Fu. 1994. The effect of B genome on the chromosome pairing relationship between the three homologous genomes A, B and C in Brassica. J. Huazhong Agric. Univ. 13(2): 111–117.
CCDB · ipcn-api-dl — Li, Z. y., H. l. Liu, J. g. Wu & P. Luo. 1996. Somaclonal variations of intergeneric hybrids between Brassica napus and Orychophragmus violaceus. Acta Genet. Sin. 23(4): 315–321.
CCDB · ipcn-api-dl — Koch, M., J. Bishop & T. Mitchell-Olds. 1999. Molecular systematics and evolution of Arabidopsis and Arabis. Pl. Biol. (Stuttgart) 1: 529–537.
CCDB · ipcn-api-dl — Vasilenko. 2003. Obtaining and the analysis of intergeneric somatic hybrids between Brassica napus and the 'Albino' line of Orychophragmus violaceus. Citol. & Genet. 37(1): 3–10.
CCDB · ipcn-api-dl — Kiehn. 2000. In K. Pascher, S. Macalka-Kampfer & H. Reiner, Vegetationsökologische und genetische Grundlagen für die Risiko-Beurteilung von Freisetzungen von Transgenem Raps und Vorschläge für ein Monitoring. Forschungsber. Bundesminist. Soziale Sicherheit Generationen Sekt. IX 7: 46.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang, Z. p. An, C. b. Chen, Z. x. Qi & Y. z. Sun. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 2, Chromosome Atlas of Crops and their Wild Kindred Plants in China Relatives. Science Press, Beijing.
CCDB · ipcn-api-dl — Hasterok, R., E. Wolny, M. Hosiawa, M. Kowalczyk, S. Kulak-Ksiazczyk, T. Ksiazczyk, W. K. Heneen & J. Maluszynska. 2006. Comparative analysis of rDNA distribution in chromosomes of various species of Brassicaceae. Ann. Bot. (Oxford) 97: 205–216.
CCDB · book-ipcn73-74 — MCNAUGHTON, I.H. 1973. Brassica napocampestris L. (2n=58). 1. synthesis, cytology, fertility and general considerations. Euphytica 22: 301-309.
CCDB · book-ipcn73-74 — VERMA, S.C. & H. REES. 1974. Nuclear DNA and the evolution of allotetraploid Brassicae. Heredity 33: 61-68.
CCDB · book-indian_vol1 — Morinaga, T. & Fukushima, E. 1930 ; Nagai, K. & Sasaoka, T. 1930a ; U, N. 1935 ; Morinaga, T. & Kuriyama, H. i937; Howard, H.W. 1938 ; Skdvsted, A. 1939 ; Sikka, S.M. 1940; Mitsukuti, Y. 1956, 1957 ;Bijok, K. 1959; Curran, P.L. 1962; Harberd, D.J. 1972; Verma, S;C. & Rees, H. 1974 ; Kamala, T. 1978 ; Mlyniec, W. et al. 1979
CCDB · eflora
CCDB · book-fedorov — Morinaga, Fukushima 1930
CCDB · book-fedorov — Nagai, Sasaoka 1930a
CCDB · book-fedorov — Morinaga, Kuriyama 1937
CCDB · book-fedorov — Howard 1938
CCDB · book-fedorov — Skovsted 1939
CCDB · book-fedorov — Sikka 1940
CCDB · book-fedorov — Mitsukuri 1956, 1957
CCDB · book-fedorov — Bijok 1959
CCDB · book-fedorov — Curran 1962
CCDB · brass — Ge & Zhang
CCDB · brass — Tang & Du
CCDB · brass — Lan et al.
CCDB · brass — Xiao & He
CCDB · brass — Du & Tang
CCDB · brass — Li
CCDB · brass — Yang et al.
CCDB · brass — Nagai & Sasaoka
CCDB · brass — Mitsukuri
+14 more references
2n 328×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · brass +1
CCDB · book-indian_vol1 — Laibach, F. 1907 ; Karpechenko, G.D. (Fedorov) ; Frandsen, N.H. & Winge, b. 1932 ; Morris, L.E. & Richharia, R.H. 1937 ; Frandsen, K.J. 1943
CCDB · book-fedorov — Laibach 1907
CCDB · book-fedorov — Kapne'leHRo 1924a, 1930, 1937a
CCDB · book-fedorov — Frandsen, Winge 1932
CCDB · book-fedorov — Frandsen 1943
CCDB · book-fedorov — Morris, Richharia 1937
CCDB · brass — Bolkhovskikh et al.
CCDB · CromoCat 2015 — Fedorov, A. A. (1969). Chromosome numbers of flowering plants 7-927
2n 206×CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 · CCDB · Cave1956 +2
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-indian_vol1 — Mukherjee, P. 1971
CCDB · book-indian_vol1 — Aryavand, A. 1976
CCDB · Cave1956 — Ahuja & Bhaduri
CCDB · Cave1959 — swam. & SUlb. 1959
CCDB · CromoCat 2015 — Goldblatt, P. (1981). Index to plant chromosome numbers 1975-1978 1-487
2n 363×CCDB · brass · CCDB · CromoCat 2015
CCDB · brass — Karpetchenko
CCDB · brass — Catcheside
CCDB · CromoCat 2015 — Majovsky, J. & al. (1978). Index of Chromosome Numbers of Slovakian Flora (Part 6) Acta Facultatis Rerum Naturalium Universitatis Comenianae Botanica 26: 1-42
2n 102×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — NA
2n 282×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Xu, L. y., P. Luo & Z. q. Lan. 1996. A study on distant hybridization between Brassica napus and Raphanus sativus var. oleifera and the formation of amphidiploids. Acta Genet. Sin. 23(2): 124–130.
CCDB · CromoCat 2015 — Xu, L.-Y., P. Luo & Z.-Q. Lan. (1996). A study on distant hybridization between Brassica napus and Raphanus sativus var. oleifera and the formation of amphidiploids Acta Genetica Sinica 23(2): 124-130
2n 181×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Prakash, S. 1973b
2n 291×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Kamala, T. 1976
n 1928×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn75-78 +3
CCDB · ipcn-api-dl — Lan, Y. z. 1986. Chromosome numbers of Brassicaceae (Cruciferae) in China. Acta Phytotax. Sin. 24: 268–272.
CCDB · ipcn-api-dl — Sheidai, M., Z. Noormohamadi, N. Mirabdolbaghi-Kashani & M.-R. Ahmadi. 2003. Cytogenetic study of some rapeseed (Brassica napus L.) cultivars and their hybrids. Caryologia 56(4): 387–397.
CCDB · ipcn-api-dl — Kamala, T. 1976. Nucleolus organizing chromosomes in Brassica and their bearing on the phylogeny of the genus. Cytologia 41: 615–620.
CCDB · book-ipcn72 — HARBERD, D.J. 1972. A contribution to the cytotaxonomy of Brassica (Cruciferael and its allies. Bot. J. Linn. Soc. 65: 1-23.
CCDB · book-ipcn75-78 — Kamala 1976
CCDB · book-ipcn73-74 — VENKATESWARLU, J. 1972. Some observations on the genomes in Brassic Proc. Indian Sci. Congr. Assoc. 59(IV: Late Abstracts) : 71-72.
CCDB · brass — Lan
CCDB · brass — Lan et al.
CCDB · brass — Li
CCDB · brass — Xiao & He
CCDB · brass — Takahata & Hinata
CCDB · brass — Mitsukuri
CCDB · brass — Morinaga
CCDB · brass — Morinaga & Fukushima
CCDB · brass — U
CCDB · brass — Howard
CCDB · brass — Sikka
CCDB · brass — Sheidai et al.
CCDB · brass — Kamala
CCDB · brass — Bijok
CCDB · CromoCat 2015 — Hosaka, K., Kianian, S. F., McGrath, J. M. & Quiros, C. F. (1990). Development and chromosomal localization of genome-specific DNA markers of Brassica and the evolution of amphidiploids and n = 9 diploid species Genome 33: 131-142
CCDB · CromoCat 2015 — Lan, Y.-Z. (1986). Chromosome numbers of Brassicaceae (Cruciferae) in China Acta Phytotaxonomica Sinica 24: 268-272
CCDB · CromoCat 2015 — Sheidai, M., Z. Noormohamadi, N. Mirabdolbaghi-Kashani & M.-R. Ahmadi (2003). Cytogenetic study of some rapeseed (Brassica napus L.) cultivars and their hybrids. Caryologia 56(4): 387–397
CCDB · CromoCat 2015 — Yang-Zhen, L. (1986). Chromosome numbers of Brassicaceae (Cruciferae) in China. Acta Phytotax. Sinica 24: 268-272.
n 106×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · brass +1
CCDB · ipcn-api-dl
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-ipcn75-78 — Kamala 1976
CCDB · book-ipcn75-78 — Aryavand 1976b
CCDB · brass — Aryavand
CCDB · CromoCat 2015 — Aryavand, A. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LII]. Taxon 25(2/3): 345-346.
n 205×CCDB · ipcn-api-dl · CCDB · brass · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Hill, M. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 128.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · brass — Khatoon & Ali
CCDB · brass — Hill
CCDB · CromoCat 2015 — Hill, L. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIV]. Taxon 31(1): 128.
n 93×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — NA
CCDB · CromoCat 2015 — Hosaka, K., Kianian, S. F., McGrath, J. M. & Quiros, C. F. (1990). Development and chromosomal localization of genome-specific DNA markers of Brassica and the evolution of amphidiploids and n = 9 diploid species Genome 33: 131-142
n 162×CCDB · brass · CCDB · Cave1959
CCDB · brass — Laibach
CCDB · Cave1959 — Raven 1959
n 182×CCDB · brass
CCDB · brass — Lan
CCDB · brass — Catcheside
n 381×CCDB · eflora
CCDB · eflora
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.6% BUSCO
07Deep time~1.52 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.52 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type63 269 records
Wild obs. + sensor59 163
Museum / vouchered3 574
Cultivated / captive124
Other408
Origin
Native108
Introduced5 806
Range
Area of Occupancy AOO136 880 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 12 385≤1 km 8 528≤10 km 29 000>10 km 136
50 049 georeferenced · 9 114 without coordinates
Open the mapobservation + sensor59 163
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 238≤1 km 841≤10 km 716>10 km 151
1 946 georeferenced · 1 628 without coordinates
Open the institutions mapphysical evidence3 574
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤1 km 2≤10 km 28>10 km 14
44 georeferenced · 80 without coordinates
Open the mapnot free-living124
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions161 of 287 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 599 |
| Paris, FR | 143 |
| Olocation not on record | 128 |
| LDlocation not on record | 93 |
| MeiseBGlocation not on record | 91 |
| Christchurch, NZ | 78 |
| Helsinki, FI | 72 |
| Pullman, US | 71 |
| Bergen, NO | 70 |
| Uniwersytet Warszawskilocation not on record | 66 |
| Odawara, JP | 61 |
| Trondheim, NO | 60 |
| Moscow State Universitylocation not on record | 57 |
| Kochi, JP | 52 |
| Nagano City, JP | 40 |
| Provincia di Livornolocation not on record | 39 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 37 |
| Quito, EC | 37 |
| Canberra, AU | 35 |
| NSMKlocation not on record | 34 |
| SLU Artdatabankenlocation not on record | 31 |
| Oskarshamn, SE | 30 |
| Adam Mickiewicz University in Poznańlocation not on record | 29 |
| South Kensington, GB | 28 |
| Görlitz, DE | 27 |
| SVK001location not on record | 27 |
| TROMlocation not on record | 27 |
| DAOlocation not on record | 26 |
| Kensington, AU | 26 |
| DBF-NHMDlocation not on record | 25 |
| BFLlocation not on record | 24 |
| Adelaide, AU | 22 |
| Mount Annan, AU | 22 |
| MAlocation not on record | 20 |
| KMNlocation not on record | 20 |
| BDBClocation not on record | 20 |
| Garðabær, IS | 19 |
| Saint Louis, US | 19 |
| Bern, CH | 19 |
| GMBAlocation not on record | 17 |
| Oulu, FI | 17 |
| Burlington, US | 17 |
| Brussel, BE | 17 |
| Barcelona, ES | 17 |
| San Diego, US | 16 |
| Kuopio, FI | 16 |
| College of the Atlantic, Museumlocation not on record | 15 |
| SIHUlocation not on record | 14 |
| BRNUlocation not on record | 12 |
| Salzburg, AT | 12 |
| Bando, JP | 12 |
| Auckland, NZ | 12 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 11 |
| Philadelphia, US | 11 |
| Riverside, US | 11 |
| Victoria, CA | 11 |
| Bangkok, TH | 10 |
| Québec, CA | 10 |
| Tomioka, JP | 10 |
| Uppsala, SE | 10 |
| Tartu, EE | 10 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 10 |
| Museo Entomologico de Leonlocation not on record | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Zürich, CH | 10 |
| Wellington, NZ | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| Université Lavallocation not on record | 9 |
| Mlocation not on record | 9 |
| San Sebastián, ES | 9 |
| BClocation not on record | 9 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 9 |
| KURAlocation not on record | 8 |
| València, ES | 8 |
| Tapachula, MX | 8 |
| Corvallis, US | 8 |
| Brisbane, AU | 8 |
| Chiba, JP | 7 |
| Tsukuba, JP | 7 |
| Kawasaki Shi Tama Ku, JP | 7 |
| Kushiro City Museumlocation not on record | 7 |
| Berlin, DE | 7 |
| Santa Barbara, US | 7 |
| New Haven, US | 7 |
| Hobart, AU | 7 |
| Jaén, ES | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Kunming, CN | 7 |
| Tromso University Museumlocation not on record | 6 |
| Bourges, FR | 6 |
| Mexico City, MX | 6 |
| KIRMlocation not on record | 6 |
| Hiratsuka City Museumlocation not on record | 6 |
| Beijing, CN | 6 |
| Ischia Marine Centrelocation not on record | 6 |
| Bloomington, US | 6 |
| Jackson, US | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| Cambridge, US | 6 |
| Turku, FI | 6 |
| Otaru, JP | 6 |
| Karlsruhe, DE | 6 |
| Central China Normal Universitylocation not on record | 6 |
| Canadian Department of Agriculturelocation not on record | 5 |
| GJOlocation not on record | 5 |
| Bronx, US | 5 |
| Emporia, US | 5 |
| Nanjing, CN | 5 |
| Zürich, CH | 5 |
| Montréal, CA | 5 |
| Sanda, JP | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| 5 | |
| Toyama, JP | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Salamanca, ES | 5 |
| Fukushima Universitylocation not on record | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Kew, GB | 4 |
| Alicante, ES | 4 |
| Chongqing Museumlocation not on record | 4 |
| Uniwersytet Jagiellońskilocation not on record | 4 |
| Chicago, US | 4 |
| Edmonton, CA | 4 |
| Flagstaff, US | 4 |
| Shinshu Universitylocation not on record | 4 |
| Santiago de Compostela, ES | 4 |
| Wlocation not on record | 4 |
| Ann Arbor, US | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| Urumqi, CN | 4 |
| nbflocation not on record | 4 |
| Anchorage, US | 4 |
| Davis, US | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| BGPAlocation not on record | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| KR | 4 |
| WTUlocation not on record | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| Elocation not on record | 4 |
| Badajoz, ES | 4 |
| Wuzhou, CN | 4 |
| UChlocation not on record | 4 |
| University of Stellenboschlocation not on record | 4 |
| CICYTEXlocation not on record | 4 |
| IDElocation not on record | 4 |
| Frauenfeld, CH | 4 |
| SZUlocation not on record | 4 |
| Chengdu, CN | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| Jyväskylä, FI | 3 |
| Winterthur, CH | 3 |
| Moscow, US | 3 |
| Acadia Universitylocation not on record | 3 |
| Chapel Hill, US | 3 |
| San Isidro, AR | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Gijón, ES | 3 |
| St. Paul, US | 3 |
| Guangzhou, CN | 3 |
| Nijmegen, NL | 3 |
| Williamsburg, US | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| KNAMlocation not on record | 3 |
| Vitoria, ES | 3 |
| Madison, US | 3 |
| CJBGlocation not on record | 3 |
| Claremont, US | 3 |
| Nanchong, CN | 3 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 3 |
| Columbia, US | 3 |
| Tilburg, NL | 3 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Loja, EC | 2 |
| Tampa, US | 2 |
| Sion, CH | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Campo Mourão, BR | 2 |
| ASUlocation not on record | 2 |
| Toronto, CA | 2 |
| Tokushima, JP | 2 |
| Dekalb, US | 2 |
| Provo, US | 2 |
| Xiamen, CN | 2 |
| Vancouver, CA | 2 |
| Fribourg, CH | 2 |
| Frankfurt am Main | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Cuenca, EC | 2 |
| Nishihara, JP | 2 |
| Kyoto Universitylocation not on record | 2 |
| College Park, US | 2 |
| UTFPR-CPlocation not on record | 2 |
| Logan, US | 2 |
| GZUlocation not on record | 2 |
| Puerto Ayora, EC | 2 |
| Richmond, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Tuscaloosa, US | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| AUAlocation not on record | 2 |
| Tallinn, EE | 2 |
| Mississippi State, US | 2 |
| Sagamihara, JP | 2 |
| Russellville, US | 2 |
| Seoul, KR | 2 |
| AASlocation not on record | 2 |
| Philadelphia, US | 2 |
| Siouxland Heritage Museumlocation not on record | 2 |
| MHNAIXlocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Conway, US | 1 |
| Chapingo, MX | 1 |
| Turlock, US | 1 |
| OLAlocation not on record | 1 |
| Taipei, TW | 1 |
| JBCLMlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Madrid, ES | 1 |
| Glarus, CH | 1 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| Riobamba, EC | 1 |
| Millersville, US | 1 |
| LfUlocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Denver, US | 1 |
| Ensenada, MX | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Taipei, TW | 1 |
| Porrentruy, CH | 1 |
| Saint John, CA | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Xining, CN | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Granada, ES | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| UTPLlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Northridge, US | 1 |
| DULlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Dresden, DE | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Mexico City, MX | 1 |
| JBSlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Henderson, US | 1 |
| UNESP-FCAVlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Allentown, US | 1 |
| Asheville, US | 1 |
| Göteborg, SE | 1 |
| ULBF-AGRlocation not on record | 1 |
| Brookings, US | 1 |
| UIBlocation not on record | 1 |
| USFSlocation not on record | 1 |
| Pamplona, ES | 1 |
| San Francisco, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Lincoln, US | 1 |
| PUC-RSlocation not on record | 1 |
| Ashland, US | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Boise, US | 1 |
| Edinburgh, GB | 1 |
| University of New Hampshirelocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Salvador, BR | 1 |
| Caldwell, US | 1 |
| CASlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Rovaniemi, FI | 1 |
| Sendai, JP | 1 |
287 institutions · 3 354 of 3 574 vouchered records shown · 145 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA126 detections
Where the DNA of Brassica napus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found126
Studies independent surveys3
Countries10
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 126 detections have coordinates
Open the map10 countries0
disturbed soilChaparral; Coastal Sage ScrubWaste ground.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 13.6–15.9
Seasonal swing summer↔winter22.5 °C
Max temp (day)19.7 °C 16.7–19.7
Min temp (night)12.6 °C 9.60–12.6
Precipitation94.3 mm/mo 72.2–490
Air humidity63.0 % 59.8–69.1
Moisture balance-1.10 mm/mo -28.0–379
Vapour deficit670 Pa 506–685
Wind speed3.60 m/s 1.20–3.60
Cloud cover44.2 % 40.5–46.3
CHELSA 1981–2010, ~9 km grid, at location & month of 88 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.