Brassica juncea
(L.) Czern. · speciesAt a glance
Occurrence records7 824
Data sources16
Biological traits141
DNA specimens33
eDNA detections34
Sources16 archives
Databases and archives Brassica juncea's data was compiled from.
WikipediaWikimedia Foundation19 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 824 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources141 traits
Chemical compositionFooDB · LOTUS · NPASS5 765 compounds
Occurrence & distributionGBIF7 824 records
Environmental DNA1 datasets · 1 countries34 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB · GIFT · GoaT≈955 Mbp
01Narrative
Brassica juncea, commonly brown mustard, Chinese mustard, Indian mustard, leaf mustard, Oriental mustard and vegetable mustard, is a species of mustard plant.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRY
Size & morphology26
Fruit length30 mm
Fruit length max50 mm
Fruit length min30 mm
Fruit width2.38 mm
Fruit width max3.5 mm
Fruit width min2 mm
Inflorescence length max1 500 cm
Inflorescence length min800 cm
Leaf length37.5 mm
Leaf length max200 mm
Leaf length min25 mm
Leaf size7 940 mm²
Leaf width65 mm
Leaf width max80 mm
Leaf width min4 mm
Plant height0.713 m
⚠ sources differ — GIFT: 0.713 m · LEDA: 0.65 m · USDA: 1.22 m · TRY: 1.16 m
Plant height generative0.8 m
Plant height max2 m
Plant height min0.3 m
Seed length1.7 mm
Seed mass2.63 mg
⚠ sources differ — TRY: 2.63 mg · GIFT: 2.26 mg
Seed mass max3 mg
Seed mass min1.84 mg
Seed width1.5 mm
Seed width max1.5 mm
Seed width min1.5 mm
Life cycle & reproduction37
After harvest regrowth rateSlow
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeself
Flower colouryellow
Flower conspicuousYes
Flower length max10 mm
Flower length min7 mm
Flowering endSep
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDARapid
Life spanannual
Lifespan categoryShort
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodFall, Winter and Spring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climberself-supporting
Elevation max3 250 m
Elevation mean1 200 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourblack
Fruit typesilique
Growth formherb
Growth form USDASingle Crown
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.003331365
Root depth min6 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinessnon-woody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min130 days
Leaf dry-matter content (LDMC)117 mg/g
Leaf n47.68 mg/g
Leaf p4.3 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min30 in
Protein potentialMedium
Salinity toleranceNone
Seed longevity index0.5
Shade toleranceHigh
Soil pH max7.2 pH
Soil pH min6 pH
Specific leaf area (SLA)24.19 mm²/mg
Temperature min17 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound283 040 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typeseed
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition5 765 compounds
Compounds documented for Brassica juncea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids127
Glycerophospholipids57
Cinnamic acids and derivatives41
Glucosinolates38
Monosaccharides26
Documented compounds5 765 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Retinol | 10,500 IU | FooDB | |
| Glycolipids | 1,914 mg/100g | FooDB | |
| 17alpha-ethynylestradiol | 1,770 mg/100g | FooDB | |
| Sugars | 1,600 mg/100g | FooDB | |
| Sodium | 717 mg/100g | FooDB |
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brassica juncea has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes10
GenBank sequences9
eDNA detections34
Countries4
The DNA barcodea real sequence read deposited for this species
ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGT …
Brassica juncea isolate S11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
AsiaOther
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL4★rbcLa★ITS5★ITS2atp6COIICOXIIItrnH-psbA
animal barcodeplant barcodefungal barcodemitochondrialmarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_016123 ↗ · 78 protein · 18 tRNA · 3 rRNA
cox2-2orf101fccmCnad2rps4nad7orf120orf105aorf114atp8orf118orf293orf113aorf110orf100aorf101aorf123orf113bnad5nad9CcmFN2atp6atp4nad4Lorf101borf265+55
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Brassica juncea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈954 861 368 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Brassica juncea0.95 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× diploid · measured
Chromosome records16–382n range36median36mode122records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 36109×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +11
CCDB · ipcn-api-dl — Du, X. & Z. j. Tang. 1989. The analysis of karyotype as an aid in tracing the evolution and relations among the six species of oil-seed rape. J. SouthW. Agric. Univ. 11: 275–278.
CCDB · ipcn-api-dl — Kamala, T. & K. A. Kumari. 1978. Morphological studies in gamma ray irradiated Brassica juncea Coss. Proc. Indian Sci. Congr. Assoc. (III, C) 65: 100.
CCDB · ipcn-api-dl — Li, R. q. 1989. Studies on Karyotypes of Vegetables in China
CCDB · ipcn-api-dl — Yang, P., R. q. Li & Z. s. Zeng. 1989. A study on the karyotype of Brassica juncea L. Pp. 349--355 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Tang, Z. J. & X. Du. 1987. Karyotype analyses of six species of oil-seed Brassica. J. SouthW. Agric. Univ. 9(1): 59–65.
CCDB · ipcn-api-dl — Xiao, C. h. & F. x. He. 1985. A preliminary analysis of the cytological technique and the karyotypes of the three main groups of oil-seed Brassica. Oil Crops China 1985(1): 11–14.
CCDB · ipcn-api-dl — Du, W., Q. x. Chen, W. l. Chen, Z. m. Wang, X. y. Hao & H. Mo. 1993. Study on karyotypes of Xinjiang wild rape, Brassica campestris, B. nigra and B. juncea. J. August 1 Agric. Coll. 16(4): 26–31.
CCDB · ipcn-api-dl — Lan, Z. q., J. m. Xu, Y. Yang, X. f. Li, J. Huang & X. h. Lian. 1994. Application of the database of chromosome image analysis in taxonomical studies of Brassicaceae. Acta Phytotax. Sin. 32(1): 41–48.
CCDB · ipcn-api-dl — Yang, G. s., G. Röbbelen & T. d. Fu. 1994. The effect of B genome on the chromosome pairing relationship between the three homologous genomes A, B and C in Brassica. J. Huazhong Agric. Univ. 13(2): 111–117.
CCDB · ipcn-api-dl — Lu, C. m. 1998. Obtaining of hybrid of Brassica juncea @x B. barrelieri and studies on homology of chromosomes between their parents. Acta Agron. Sin. 24(5): 544–549.
CCDB · ipcn-api-dl — Mukherjee, P. 1975b. Chromosome study as an aid in tracing the evolution in Cruciferae. Cytologia 40: 727–734.
CCDB · ipcn-api-dl — Mukherjee, P. 1976. Chromosome studies of the tribe Brassiceae. Proc. Indian Sci. Congr. Assoc. 63: 117.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Hasterok, R., E. Wolny, M. Hosiawa, M. Kowalczyk, S. Kulak-Ksiazczyk, T. Ksiazczyk, W. K. Heneen & J. Maluszynska. 2006. Comparative analysis of rDNA distribution in chromosomes of various species of Brassicaceae. Ann. Bot. (Oxford) 97: 205–216.
CCDB · book-ipcn75-78 — Ghosh Das tidar et al. 1978
CCDB · book-ipcn75-78 — Mukherjee 1975b
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-ipcn75-78 — Mukherjee 1976
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-ipcn73-74 — MUKHERJEE, P. 1973. Karyotypic studies of different cultivated strains of Indian mustard. Proc. Indian Sci. Congr. Assoc. 60(III): 640.
CCDB · book-ipcn73-74 — VERMA, S.C. & H. REES. 1974. Nuclear DNA and the evolution of allotetraploid Brassicae. Heredity 33: 61-68.
CCDB · book-indian_vol1 — Karpechenko, G.D. (Fedorov) ; Shimo tomai, N. 1925; Nagai,K. & Sasaoka, T. 1930a; Haga, T. 1938; Sikka, S.M. 1940; Frandsen,-K.J. 1943 ; Mitsukuri, Y. 1957; Mulligan, G.A.1959 ;Curran,P.L. 1962; Prakash, S. 1973b ; Mukherjee, P. 1975a, b, 1976
CCDB · book-indian_vol1 — Harberd, D.J. 1972; Verma, S.C. & Rees, H. 1974; Kamala, T. 1978
CCDB · book-indian_vol1 — Sarkar, A.K. et al. 1973a
CCDB · eflora
CCDB · book-fedorov — Shimotomai 1925
CCDB · book-fedorov — Morinaga 1929a, .b
CCDB · book-fedorov — Yarnell 1956
CCDB · book-fedorov — Mitsukuri 1956
CCDB · book-fedorov — Kapne'leHRo 1924a, 1937a
CCDB · book-fedorov — Nagai, Sasaoka 1930a
CCDB · book-fedorov — Haga 1938a
CCDB · book-fedorov — Sikka 1940
CCDB · book-fedorov — Frandsen 1943
CCDB · book-fedorov — Mitsukuri 1957
CCDB · book-fedorov — Mulligan 1959
CCDB · book-fedorov — Curran 1962
CCDB · brass — Mulligan
CCDB · brass — Chen & Yang
+41 more references
2n 207×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1
CCDB · ipcn-api-dl — Kakes, P. 1979. Genecological investigations on zinc plants III. Cytology of hybrids between Viola calaminaria (Lej.) Ernst and Viola arvensis Murr. Genetica 51: 135–142.
CCDB · book-fedorov — Shimotomai 1925
CCDB · book-fedorov — Morinaga 1929a
CCDB · book-fedorov — Mitsukuri 1957
CCDB · book-fedorov — Curran 1962
CCDB · book-atlas-flowering-plants — Shimotomai 1925
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
2n 162×CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · book-indian_vol1 — Kamala, T. 1978
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
2n 382×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-fedorov — Sikka 1940
CCDB · book-atlas-flowering-plants — Sikk:a 1940
2n 181×CCDB · book-fedorov
CCDB · book-fedorov — Manton 1932
2n 221×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
n 1848×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn75-78 +3
CCDB · ipcn-api-dl — Lan, Y. z. 1986. Chromosome numbers of Brassicaceae (Cruciferae) in China. Acta Phytotax. Sin. 24: 268–272.
CCDB · ipcn-api-dl — Hosaka, K., S. F. Kianian, J. M. McGrath & C. F. Quiros. 1990. Development and chromosomal localization of genome-specific DNA markers of Brassica and the evolution of amphidiploids and n = 9 diploid species. Genome 33: 131–142.
CCDB · ipcn-api-dl — Kamala, T. 1976. Nucleolus organizing chromosomes in Brassica and their bearing on the phylogeny of the genus. Cytologia 41: 615–620.
CCDB · ipcn-api-dl — Al-Shehbaz, I. A. & M. M. Al-Omar. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 587–589.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn72 — HARBERD, D.J. 1972. A contribution to the cytotaxonomy of Brassica (Cruciferael and its allies. Bot. J. Linn. Soc. 65: 1-23.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · book-ipcn75-78 — Kamala 1976
CCDB · book-ipcn73-74 — SARKAR, A.K., N. DATTA., & U. CHATTERJEE. 1973. In IOPB chromosome number reports XLII. Taxon 22: 647-654.
CCDB · book-ipcn73-74 — VENKATESWARLU, J. 1972. Some observations on the genomes in Brassic Proc. Indian Sci. Congr. Assoc. 59(IV: Late Abstracts) : 71-72.
CCDB · brass — Lan & Cheo
CCDB · brass — Lan
CCDB · brass — Lan et al.
CCDB · brass — Sikka
CCDB · brass — Harberd
CCDB · brass — Sarkar et al.
CCDB · brass — Takahata & Hinata
CCDB · brass — Al-Shehbaz & Al-Omar
CCDB · brass — Mitsukuri
CCDB · brass — Kamala
CCDB · brass — Shimotomai
CCDB · brass — U
CCDB · brass — Sharma
CCDB · CromoCat 2015 — Hosaka, K., Kianian, S. F., McGrath, J. M. & Quiros, C. F. (1990). Development and chromosomal localization of genome-specific DNA markers of Brassica and the evolution of amphidiploids and n = 9 diploid species Genome 33: 131-142
CCDB · CromoCat 2015 — Lan, Y.-Z. (1986). Chromosome numbers of Brassicaceae (Cruciferae) in China Acta Phytotaxonomica Sinica 24: 268-272
CCDB · CromoCat 2015 — Al-Shehbaz, I. A. & Al-Omar, M. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(3): 587-589.
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
n 103×CCDB · ipcn-api-dl · CCDB · brass · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Lan, Y. z. 1986. Chromosome numbers of Brassicaceae (Cruciferae) in China. Acta Phytotax. Sin. 24: 268–272.
CCDB · brass — Lan
CCDB · CromoCat 2015 — Lan, Y.-Z. (1986). Chromosome numbers of Brassicaceae (Cruciferae) in China Acta Phytotaxonomica Sinica 24: 268-272
n 161×CCDB · brass
CCDB · brass — Lan
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.7% BUSCO
08Occurrence & distribution
Record type7 824 records
Wild obs. + sensor3 884
Museum / vouchered3 497
Cultivated / captive99
Other344
Origin
Native5
Introduced709
Range
Area of Occupancy AOO19 428 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 1 080≤1 km 559≤10 km 1 235>10 km 211
3 085 georeferenced · 799 without coordinates
Open the mapobservation + sensor3 884
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 244≤1 km 392≤10 km 580>10 km 256
1 472 georeferenced · 2 025 without coordinates
Open the institutions mapphysical evidence3 497
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤1 km 2≤10 km 21>10 km 2
25 georeferenced · 74 without coordinates
Open the mapnot free-living99
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions188 of 312 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 172 |
| LDlocation not on record | 140 |
| Beijing, CN | 135 |
| Olocation not on record | 110 |
| DAOlocation not on record | 103 |
| Odawara, JP | 101 |
| Moscow State Universitylocation not on record | 91 |
| Nanjing, CN | 70 |
| SLU Artdatabankenlocation not on record | 70 |
| MeiseBGlocation not on record | 65 |
| Christchurch, NZ | 57 |
| Chongqing Museumlocation not on record | 53 |
| Philadelphia, US | 51 |
| Chengdu, CN | 51 |
| Tapachula, MX | 49 |
| QAUlocation not on record | 49 |
| Bronx, US | 48 |
| Philadelphia, US | 47 |
| Saint Louis, US | 46 |
| Oulu, FI | 44 |
| Bern, CH | 38 |
| Brisbane, AU | 36 |
| Wuzhou, CN | 30 |
| Oskarshamn, SE | 30 |
| Baroda, IN | 29 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 29 |
| Canadian Department of Agriculturelocation not on record | 28 |
| Guilin, CN | 27 |
| Bergen, NO | 26 |
| Tampa, US | 24 |
| Mount Annan, AU | 23 |
| Bando, JP | 23 |
| Madison, US | 22 |
| Auckland, NZ | 20 |
| Chiba, JP | 20 |
| Adelaide, AU | 19 |
| University of New Hampshirelocation not on record | 19 |
| Canberra, AU | 18 |
| Nagano City, JP | 18 |
| Durango, MX | 18 |
| NSMKlocation not on record | 18 |
| BFLlocation not on record | 18 |
| DBF-NHMDlocation not on record | 18 |
| Trondheim, NO | 17 |
| Turku, FI | 17 |
| Burlington, US | 17 |
| St. Paul, US | 16 |
| Davis, US | 16 |
| Xining, CN | 16 |
| Tartu, EE | 16 |
| Pullman, US | 15 |
| Uppsala, SE | 15 |
| Urumqi, CN | 14 |
| National Biodiversity Institute, Costa Ricalocation not on record | 14 |
| Sanda, JP | 14 |
| University of Stellenboschlocation not on record | 13 |
| Lanzhou, CN | 13 |
| Missoula, US | 13 |
| Jena Microbial Resource Collectionlocation not on record | 13 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 13 |
| Chicago, US | 13 |
| Fort Worth, US | 13 |
| Austin, US | 12 |
| BAYLUlocation not on record | 12 |
| University of Alberta Museumslocation not on record | 12 |
| National Institute of Biological Resourceslocation not on record | 12 |
| Zürich, CH | 12 |
| South Kensington, GB | 12 |
| Pretoria, ZA | 12 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 12 |
| Tokushima, JP | 12 |
| Mexico City, MX | 12 |
| KURAlocation not on record | 11 |
| Salzburg, AT | 11 |
| Victoria, CA | 11 |
| Kochi, JP | 11 |
| CASlocation not on record | 11 |
| Fukushima Universitylocation not on record | 11 |
| Riverside, US | 10 |
| Flagstaff, US | 10 |
| Kawasaki Shi Tama Ku, JP | 10 |
| Görlitz, DE | 10 |
| Guangzhou, CN | 10 |
| Allentown, US | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 9 |
| Toyama, JP | 9 |
| KMNlocation not on record | 9 |
| Puerto Ayora, EC | 9 |
| Tsukuba, JP | 9 |
| Vancouver, CA | 9 |
| Toronto, CA | 8 |
| POL003location not on record | 8 |
| Staten Island, US | 8 |
| Mlocation not on record | 8 |
| Acadia Universitylocation not on record | 8 |
| Corvallis, US | 8 |
| Kunming, CN | 8 |
| Dekalb, US | 8 |
| Tomioka, JP | 8 |
| Kew, GB | 7 |
| Mexico City, MX | 7 |
| Servico de Microbiologia e Imunologialocation not on record | 7 |
| Brussel, BE | 7 |
| New Haven, US | 7 |
| Kensington, AU | 7 |
| IDElocation not on record | 7 |
| Bloomington, US | 7 |
| Hiratsuka City Museumlocation not on record | 7 |
| Montréal, CA | 7 |
| Lincoln, US | 7 |
| Phoenix, US | 7 |
| GMBAlocation not on record | 7 |
| Paris, FR | 7 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| BISHlocation not on record | 6 |
| GBR006location not on record | 6 |
| Sagamihara, JP | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Parthenon Tama History Museumlocation not on record | 6 |
| Honolulu, US | 6 |
| Bangkok, TH | 6 |
| Altos de Pipe, VE | 6 |
| Provincia di Livornolocation not on record | 6 |
| Jackson, US | 5 |
| Bozeman, US | 5 |
| Little Rock, US | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| IEBlocation not on record | 5 |
| TUR-Alocation not on record | 5 |
| San Diego, US | 5 |
| Logan, US | 5 |
| Ann Arbor, US | 5 |
| Kuopio, FI | 5 |
| ASUlocation not on record | 5 |
| Nishihara, JP | 5 |
| Turlock, US | 5 |
| Emporia, US | 4 |
| EL PASO, US | 4 |
| Davenport, US | 4 |
| Siouxland Heritage Museumlocation not on record | 4 |
| San José, CR | 4 |
| Tallinn, EE | 4 |
| Santa Barbara, US | 4 |
| Zürich, CH | 4 |
| KIRMlocation not on record | 4 |
| Austin, US | 4 |
| Claremont, US | 4 |
| Mississippi State, US | 4 |
| Nagatoro-machi, Chichibu-gun, JP | 4 |
| Nishihara, JP | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Durban, ZA | 4 |
| Miami, US | 4 |
| Valdosta State Universitylocation not on record | 4 |
| Universidad Católica de Santa Maríalocation not on record | 3 |
| Spearfish, US | 3 |
| Chicago, US | 3 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Pittsburg, US | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| College Park, US | 3 |
| Williamsburg, US | 3 |
| Elocation not on record | 3 |
| Kushiro City Museumlocation not on record | 3 |
| Shanxi Institute of Biologylocation not on record | 3 |
| Saint John, CA | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| BDBClocation not on record | 3 |
| Osaka, JP | 3 |
| Xiamen, CN | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Armidale, AU | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| BIO-UNIPIlocation not on record | 3 |
| KR | 3 |
| Pocatello, US | 2 |
| San Isidro, AR | 2 |
| Denver, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| GAlocation not on record | 2 |
| Dehra Dun, IN | 2 |
| Columbia, US | 2 |
| FJIDClocation not on record | 2 |
| Porvoo, FI | 2 |
| Philadelphia, US | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Jyväskylä, FI | 2 |
| Rotorua, NZ | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| GB | 2 |
| Berlin, DE | 2 |
| St. Augustine, TT | 2 |
| Taipei, TW | 2 |
| Sendai, JP | 2 |
| Mérida, MX | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| Springfield, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Arcata, US | 2 |
| China Agricultural Universitylocation not on record | 2 |
| BClocation not on record | 2 |
| Cape Town, ZA | 2 |
| Guiyang, CN | 2 |
| KNAMlocation not on record | 2 |
| Museo universitario di Chietilocation not on record | 2 |
| JP | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Umeå Universitylocation not on record | 2 |
| Denton, US | 2 |
| Taipei, TW | 2 |
| Universität Basel, Herbariumlocation not on record | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| US | 2 |
| Nijmegen, NL | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Wlocation not on record | 2 |
| Moscow, US | 2 |
| Tacoma, US | 1 |
| Santa Cruz, US | 1 |
| Iquitos, PE | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| Richmond, US | 1 |
| San Luis Obispo, US | 1 |
| Juriquilla, MX | 1 |
| Corrientes, AR | 1 |
| Johnson City, US | 1 |
| Orem, US | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| UnBlocation not on record | 1 |
| KIWElocation not on record | 1 |
| Portland, US | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Barcelona, ES | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Fribourg, CH | 1 |
| JBRJlocation not on record | 1 |
| UERJlocation not on record | 1 |
| Podgorica, ME | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Guangzhou, CN | 1 |
| Waverly, US | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| ENTClocation not on record | 1 |
| Guatemala City, GT | 1 |
| Frauenfeld, CH | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| Otaru, JP | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Montecillo, Texcoco, MX | 1 |
| Zapopan, MX | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| ESP003location not on record | 1 |
| BGR001location not on record | 1 |
| LBVlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Dover, US | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Changsha, CN | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Wuhan, CN | 1 |
| Guiyang, CN | 1 |
| Seoul, KR | 1 |
| Tilburg, NL | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| San Angelo, US | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| León, NI | 1 |
| Vitoria, ES | 1 |
| Shinshu Universitylocation not on record | 1 |
| Plocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Chapel Hill, US | 1 |
| Wellington, NZ | 1 |
| Batemans Bay, AU | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Maringá, BR | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Albuquerque, US | 1 |
| IMMUlocation not on record | 1 |
| Stockholm, SE | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Palmerston, AU | 1 |
| TAIElocation not on record | 1 |
| TROMlocation not on record | 1 |
| Long Beach, US | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| SIHUlocation not on record | 1 |
| Lubbock, US | 1 |
| Washington, US | 1 |
| Boise, US | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Edmonton, CA | 1 |
| Taipei, TW | 1 |
| Parkville, AU | 1 |
| Campo Grande, BR | 1 |
| MEXUlocation not on record | 1 |
312 institutions · 3 302 of 3 497 vouchered records shown · 193 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA34 detections
Where the DNA of Brassica juncea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found34
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 34 detections have coordinates
Open the map1 country0
Mauvaise herbe dans un champ de cereales.Small unmowed portion of private lot at Rivi…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.5 °C 17.5–17.5
Seasonal swing summer↔winter31.2 °C
Max temp (day)22.5 °C
Min temp (night)12.7 °C
Precipitation122 mm/mo
Air humidity57.8 %
Moisture balance-10.4 mm/mo
Vapour deficit843 Pa
Wind speed2.90 m/s
Cloud cover50.5 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.