Brachypodium pinnatum
(L.) P.Beauv. · speciesAt a glance
Occurrence records142 247
Data sources12
Biological traits50
DNA specimens41
eDNA detections26
Sources12 archives
Databases and archives Brachypodium pinnatum's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility142 247 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics41 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources50 traits
Occurrence & distributionGBIF142 247 records
Environmental DNA1 datasets · 8 countries26 detections
DNA & barcodingBOLD · NCBI41 specimens
Genome at a glanceCCDB · GoaT763 Mbp
01Narrative
Brachypodium pinnatum, the heath false brome or tor-grass, is a species of grass with a widespread distribution in temperate regions of the Northern Hemisphere. It typically grows in calcareous grassland, and reaches 70 – tall. The flowerhead is open, with 10 to 15 erect spikelets.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVP
Size & morphology14
Leaf length max125 mm
Leaf mass83.99 mg
Leaf size552 mm²
⚠ sources differ — TRY: 552 mm² · LEDA: 1 898 mm² · GIFT: 1 400 mm²
Leaf width3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height0.533 m
⚠ sources differ — GIFT: 0.533 m · TRY: 0.319 m
Plant height generative0.407 m
Plant height max1.2 m
Plant height min0.25 m
Seed length10.17 mm
Seed mass2.85 mg
Seed mass max4.74 mg
Seed mass min1.14 mg
Life cycle & reproduction14
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJul
Flowering startJun
Life formperennial or rhizomatous geophyte
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: perennial
Lifespan years3 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number32 544
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 300 m
Elevation mean3 550 m
Elevation min2 800 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, mountains
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio22.1 g/g
Leaf c470 mg/g
Leaf dry-matter content (LDMC)315 mg/g
⚠ sources differ — TRY: 315 mg/g · LEDA: 350 mg/g
Leaf n19.3 mg/g
Leaf p1.2 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)27.68 mm²/mg
⚠ sources differ — TRY: 27.68 mm²/mg · LEDA: 21.7 mm²/mg · GIFT: 24.01 mm²/mg
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding41 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brachypodium pinnatum has left across the world's sequence archives.
At a glance
DNA specimens41
Marker genes9
GenBank sequences10
eDNA detections26
Countries8
The DNA barcodea real sequence read deposited for this species
CGCCAAAACACGCTCCCACCCCCCCTCGTGGGGAGCAGGACGCGGCTTATGGCTCCCCGTGCCTTTGGGCGCGGTTGGCCGAAGATCGGG …
Brachypodium pinnatum voucher XH-65 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL6★rbcLa★trnL-F★ITS4★ITS1★ITS2cp-trnL-introntrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Brachypodium pinnatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size762 840 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Brachypodium pinnatum0.76 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× / 4× cytotypes
Chromosome records14–362n range28median28mode70records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2830×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Murín A. & Feráková V., 1981: Karyological study of Slovakian flora III. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 28: 59-62.
CCDB · brit-fl — Khan, M.A. (1984)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Revision der europischen arten der Gattung Brachypodium Palisot de Beauvois (Poaceae). Schippmann, U.Boissiera45: 1-250(1991).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4619
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4620
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · poland — Schippmann U. 1991. Revision der europaischen Arten der Gattung Brachypodium Palisot de Beauvois (Poaceae). Boissiera 45, 8-249.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Shi, Y., J. Draper & C. Stace. 1993. Ribosomal DNA variation and its phylogenetic implication in the genus Brachypodium (Poaceae). Pl. Syst. Evol. 188: 125–138.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Robertson, I. H. 1981. Chromosome numbers in Brachypodium Beauv. (Gramineae). Genetica 56: 55–60.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — LEVEQUE, M., & R. GORENFLOT. 1969. Prospections caryologiques dans la flore littorale du Boulonnais. Bull. soc. Bot. Nord France 22: 27-58.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-northern-plants — Kattermann 1930. L. & L. 1944 b.
CCDB · book-atlas-flowering-plants — L. & L. 1944b
CCDB · kew — Wolny E, Hasterok R. 2009. Comparative cytogenetic analysis of the genomes of the model grass Brachypodium distachyon and its close relatives. Annals of Botany 104: 873-881.
CCDB · Cave1956 — Tateoka b
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.
CCDB · CromoCat 2015 — Kozuharov, S. J. & Petrova, A. V. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 286-287.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Stoeva, M. (1974b). Chromosomal variation in the Brachypodium genus in Bulgaria with a regard to its evolution and taxonomy. Genet. Polon. 15: 13-23.
2n 1821×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · brit-fl +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — D'OVIDIO R., LUCCHESE F. - 1986. Chromosomal races in the Brachypodium rupestre complex in Italy.. Ann. Bot. (Rome) , 44: 175-180.
CCDB · brit-fl — Robertson, I.H. Genetica 56: 55-60 (1981)
CCDB · poland — Mizianty M. and Frey L. 2007. Cytology. In: M. Mizianty and L. Frey (eds.), Biodiversity of wild Triticeae (Poaceae) in Poland as an expression of tribe microevolution. W. Szafer Institute of Botany, Polish Academy of Sciences, Krakw. pp.47-51.
CCDB · ipcn-api-dl — Strid, A. 1983. In IOPB chromosome number reports LXXVIII. Taxon 32: 138–140.
CCDB · ipcn-api-dl — Murin, A. & V. Ferakova. 1981. Caryological study of Slovakian flora III. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 28: 59–62.
CCDB · ipcn-api-dl
CCDB · kew — Wolny E, Hasterok R. 2009. Comparative cytogenetic analysis of the genomes of the model grass Brachypodium distachyon and its close relatives. Annals of Botany 104: 873-881.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Stoeva, M. (1974b). Chromosomal variation in the Brachypodium genus in Bulgaria with a regard to its evolution and taxonomy. Genet. Polon. 15: 13-23.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1983a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVIII]. Taxon 32(1): 138-140.
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
2n 3611×CCDB · ita-fl · CCDB · ipcn-api-dl
CCDB · ita-fl — D'OVIDIO R., LUCCHESE F. - 1986. Chromosomal races in the Brachypodium rupestre complex in Italy.. Ann. Bot. (Rome) , 44: 175-180.
CCDB · ita-fl — Lucchese F. - 1989. La distribuzione dei complessi Brachypodium pinnatum e B. rupestre nelle alpi orientali e dinariche. Atti del Simposio della Societ Estalpino-dinarica di Fitosociologia, Feltre 29/6-3/7 1988 , : 147-159.
CCDB · ipcn-api-dl — Shi, Y., J. Draper & C. Stace. 1993. Ribosomal DNA variation and its phylogenetic implication in the genus Brachypodium (Poaceae). Pl. Syst. Evol. 188: 125–138.
2n 145×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.
CCDB · CromoCat 2015 — Kozuharov, S. J. & Petrova, A. V. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 286-287.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Stoeva, M. (1974b). Chromosomal variation in the Brachypodium genus in Bulgaria with a regard to its evolution and taxonomy. Genet. Polon. 15: 13-23.
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
2n 163×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.
CCDB · CromoCat 2015 — Kozuharov, S. J. & Petrova, A. V. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 286-287.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Stoeva, M. (1974b). Chromosomal variation in the Brachypodium genus in Bulgaria with a regard to its evolution and taxonomy. Genet. Polon. 15: 13-23.
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
n 91×CCDB · ita-fl
CCDB · ita-fl — D'OVIDIO R., LUCCHESE F. - 1986. Chromosomal races in the Brachypodium rupestre complex in Italy.. Ann. Bot. (Rome) , 44: 175-180.
n 181×CCDB · ita-fl
CCDB · ita-fl — D'OVIDIO R., LUCCHESE F. - 1986. Chromosomal races in the Brachypodium rupestre complex in Italy.. Ann. Bot. (Rome) , 44: 175-180.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.125 ↗
07Deep time~3.52 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin3.52 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type142 247 records
Wild obs. + sensor131 910
Museum / vouchered8 042
Cultivated / captive221
Other2 074
Origin
Native4 272
Introduced74
Range
Area of Occupancy AOO183 640 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 20 887≤1 km 16 687≤10 km 46 449>10 km 2 376
86 399 georeferenced · 45 511 without coordinates
Open the mapobservation + sensor131 910
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy31% within 1 km
≤100 m 643≤1 km 1 075≤10 km 2 917>10 km 829
5 464 georeferenced · 2 578 without coordinates
Open the institutions mapphysical evidence8 042
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 5
5 georeferenced · 216 without coordinates
Open the mapnot free-living221
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions74 of 161 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 564 |
| Helsinki, FI | 647 |
| BFLlocation not on record | 476 |
| Moscow State Universitylocation not on record | 437 |
| LDlocation not on record | 329 |
| Uppsala, SE | 265 |
| Tartu, EE | 224 |
| Olocation not on record | 208 |
| SLU Artdatabankenlocation not on record | 192 |
| Salzburg, AT | 162 |
| Berlin, DE | 157 |
| MeiseBGlocation not on record | 146 |
| Turku, FI | 92 |
| Tallinn, EE | 92 |
| Uniwersytet Jagiellońskilocation not on record | 81 |
| Oskarshamn, SE | 78 |
| Provincia di Livornolocation not on record | 77 |
| Adam Mickiewicz University in Poznańlocation not on record | 77 |
| Görlitz, DE | 74 |
| Oulu, FI | 69 |
| Irkutsk State Universitylocation not on record | 68 |
| BIO-UNIPIlocation not on record | 65 |
| Kuopio, FI | 56 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 51 |
| BRNUlocation not on record | 42 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 33 |
| Karlsruhe, DE | 29 |
| South Kensington, GB | 28 |
| GJOlocation not on record | 28 |
| Barcelona, ES | 27 |
| Bern, CH | 26 |
| Dresden, DE | 25 |
| TUR-Alocation not on record | 25 |
| BClocation not on record | 23 |
| SZUlocation not on record | 22 |
| Jyväskylä, FI | 21 |
| Pamplona, ES | 21 |
| València, ES | 20 |
| Zürich, CH | 19 |
| MAlocation not on record | 18 |
| Mlocation not on record | 18 |
| Entomological Society of Latvialocation not on record | 16 |
| Salamanca, ES | 16 |
| Paris, FR | 15 |
| Zürich, CH | 15 |
| Vitoria, ES | 15 |
| PRClocation not on record | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| Beijing, CN | 13 |
| Wlocation not on record | 13 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 13 |
| DBF-NHMDlocation not on record | 12 |
| UGentlocation not on record | 12 |
| Bergen, NO | 11 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 11 |
| IB FRC Komi SC UB RASlocation not on record | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Trondheim, NO | 10 |
| Philadelphia, US | 9 |
| Christchurch, NZ | 8 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 8 |
| Auckland, NZ | 8 |
| CZE082location not on record | 7 |
| HUN003location not on record | 7 |
| CICYTEXlocation not on record | 7 |
| PrivatHerblocation not on record | 7 |
| Frankfurt am Main | 7 |
| BDBClocation not on record | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| GZUlocation not on record | 7 |
| Porvoo, FI | 6 |
| University of Stellenboschlocation not on record | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Bourges, FR | 6 |
| National Museum Waleslocation not on record | 5 |
| Forssa, FI | 5 |
| Stockholm, SE | 5 |
| LfUlocation not on record | 5 |
| Brussel, BE | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Canberra, AU | 4 |
| BSBIlocation not on record | 4 |
| Winterthur, CH | 4 |
| TROMlocation not on record | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| Kew, GB | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Uniwersytet Warszawskilocation not on record | 3 |
| Fulda, DE | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| BGR001location not on record | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| Tilburg, NL | 3 |
| Xiamen, CN | 3 |
| ROM007location not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Yunnan Universitylocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| BioFokuslocation not on record | 2 |
| Bloomington, US | 2 |
| US | 2 |
| Sevilla, ES | 2 |
| Podgorica, ME | 2 |
| CIBIOlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Taipei, TW | 2 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 2 |
| Porrentruy, CH | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Durham, US | 2 |
| H-Schuhwlocation not on record | 2 |
| Urumqi, CN | 2 |
| Hitchin Museumlocation not on record | 2 |
| Davis, US | 2 |
| Hobart, AU | 2 |
| KMNlocation not on record | 2 |
| nbflocation not on record | 2 |
| H-AkrKGlocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Smithfield, AU | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Madrid, ES | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Albuquerque, US | 1 |
| H-Dunkellocation not on record | 1 |
| SVN019location not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Rovaniemi, FI | 1 |
| NoColllocation not on record | 1 |
| Dekalb, US | 1 |
| Corvallis, US | 1 |
| München, DE | 1 |
| Uberlândia, BR | 1 |
| CJBGlocation not on record | 1 |
| Columbia, US | 1 |
| Moscow, US | 1 |
| Jaén, ES | 1 |
| Chapel Hill, US | 1 |
| Sion, CH | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Coimbra, PT | 1 |
| Xining, CN | 1 |
| Bronx, US | 1 |
| Alicante, ES | 1 |
| Tromso University Museumlocation not on record | 1 |
| Monastir, TN | 1 |
| Namur, BE | 1 |
| OLAlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Granada, ES | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
161 institutions · 7 619 of 8 042 vouchered records shown · 355 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Brachypodium pinnatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map8 countries0
In limestone field
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.0 °C 13.4–18.8
Seasonal swing summer↔winter15.7 °C
Max temp (day)20.2 °C 16.4–23.6
Min temp (night)13.0 °C 9.20–14.0
Precipitation77.6 mm/mo 27.6–103
Air humidity60.2 % 53.2–64.9
Moisture balance-37.4 mm/mo -105–-9.80
Vapour deficit776 Pa 587–949
Wind speed3.80 m/s 2.60–4.80
Cloud cover43.2 % 35.1–51.1
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.