Brachypelma boehmei

Schmidt & Klaas, 1993 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Brachypelma

At a glance

Occurrence records0

Data sources8

Biological traits1

DNA specimens7

eDNA detections6

Sources8 archives

Databases and archives Brachypelma boehmei's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Brachypelma boehmei (also known as the Mexican fireleg, or the Mexican rustleg tarantula) is a tarantula native to Mexico in Guerrero state.Map These long-lived tarantulas prefer burrowing and hiding in dry scrubland. As with all closely related tarantula species, they defend themselves with urticating hair when provoked.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesIUCN 2019

Ecology1

Global IUCN Red List categoryEndangered (EN)

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Brachypelma boehmei has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P659 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes1

BINs2

Where individuals differ — all 17 variable positions, in barcode order

22Avariable

37Gmostly conserved

49Amostly conserved

76Gmostly conserved

145Amostly conserved

166Gmostly conserved

172Cmostly conserved

175Avariable

190Amostly conserved

265Gmostly conserved

268Gmostly conserved

311Gmostly conserved

313Cmostly conserved

412Amostly conserved

511Gmostly conserved

628Avariable

634Cmostly conserved

AACATTGTATTTGTTGTTTGGAATTTGGTCTTCTATGGTGGGAACTGCAATAAGAGTAATTATTCGGGTTGAATTGGGACAGGTTGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Brachypelma baumgartenisame genus1.8%Brachypelma auratumsame genus2.0%Brachypelma smithisame genus4.3%Brachypelma hamoriisame genus8.3%Brachypelma emiliasame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

09Environmental DNA6 detections

Where the DNA of Brachypelma boehmei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 12.2–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C 19.0–22.0

Min temp (night)9.00 °C 5.80–9.00

Precipitation34.7 mm/mo 18.9–34.7

Air humidity50.9 % 49.0–50.9

Moisture balance-93.3 mm/mo -93.3–-75.8

Vapour deficit884 Pa 733–884

Wind speed4.10 m/s 3.90–4.10

Cloud cover25.5 % 25.5–28.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)