Bossiaea bossiaeoides

(A.Cunn. ex Benth.) Court · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Bossiaea

At a glance

Occurrence records1 261

Data sources8

Biological traits25

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Bossiaea bossiaeoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF1 261 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Bossiaea bossiaeoides is a species of flowering plant in the family Fabaceae and is endemic to northern Australia. It is much-branched, glabrous shrub with broadly winged stems, winged and lobed cladodes, leaves reduced to small scales, and yellow flowers, sometimes with orange or red blotches.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length42.5 mm

Fruit width8 mm

Leaf mass per area157 g/m2

Plant height2 m

Plant height max5 m

Plant height min0.5 m

Seed length4 mm

Seed width2.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeyyyyyynnnnny

Life formshrub

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bossiaea bossiaeoides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSKM876849.1 ↗643 bp

ACGT

GAGCAATGTGCCATGCGATATGTTTTTCTATCAAACGGTTGGTTTGCGGTGTTTAACGCCTCAACAGCCAAAAACTTGCGGGAGGTGCTC …

Bossiaea bossiaeoides voucher JHR4753 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type1 261 records

Wild obs. + sensor828

Museum / vouchered422

Other11

Origin

Native38

Range

Area of Occupancy AOO3 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 478≤1 km 11≤10 km 16>10 km 9

514 georeferenced · 314 without coordinates

Open the mapobservation + sensor828

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 56≤1 km 54≤10 km 179>10 km 46

335 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence422

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	107
Canberra, AU	73
Kensington, AU	68
Museo Entomologico de Leonlocation not on record	55
Brisbane, AU	43
Mount Annan, AU	27
Adelaide, AU	15
Kew, GB	10
Saint Louis, US	5
Armidale, AU	3
BGPAlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	2
James Cook Townsvillelocation not on record	1
University of Stellenboschlocation not on record	1
LDlocation not on record	1
Smithfield, AU	1

16 institutions · 415 of 422 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Bossiaea bossiaeoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bossiaea bossiaeoides

At a glance

Sources8 archives

Size & morphology8

Life cycle & reproduction6

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

At a glance

Record type1 261 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 261 records