Bossiaea aquifolium

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Bossiaea

At a glance

Occurrence records210

Data sources12

Biological traits26

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Bossiaea aquifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility210 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF210 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Bossiaea aquifolium, commonly known as water bush, nedik or netic, is a species of flowering plant in the pea family Fabaceae and is endemic to Southwest Australia. It is a slender shrub or small tree with egg-shaped leaves arranged in opposite pairs and yellowish flowers arranged singly or in pairs on the ends of branchlets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length10.5 mm

Leaf width13.5 mm

Plant height8 m

Plant height max8 m

Plant height min0.6 m

Seed mass11.56 mg

⚠ sources differ — TRY: 11.56 mg · AusTraits: 8.55 mg · GIFT: 10.59 mg

Seed mass max15.6 mg

Seed mass min8.07 mg

Life cycle & reproduction6

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typelegume

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub · TRY: shrub/tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Bossiaea aquifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Phenylethylamines1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Tyramine		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bossiaea aquifolium has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKM876842.1 ↗652 bp

ACGT

TGTCGATGCCTCACAAGCAATGTGCCATGTGAATATGTTTTTCTAGCAAATGGTTGTTCGTGGTGTTTAACACCTTGACAACCTAAATAT …

Bossiaea laidlawiana voucher TRL441 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Bossiaea aquifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 197 5

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type210 records

Wild obs. + sensor188

Museum / vouchered22

Origin

Native3

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 123≤1 km 15≤10 km 8>10 km 7

153 georeferenced · 35 without coordinates

Open the mapobservation + sensor188

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 2≤10 km 6>10 km 5

13 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	6
Mount Annan, AU	3
Hobart, AU	3
Museo Entomologico de Leonlocation not on record	2
Armidale, AU	2
LDlocation not on record	2
Kensington, AU	1
Parkville, AU	1
Brisbane, AU	1
Adelaide, AU	1

10 institutions · 22 of 22 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Bossiaea aquifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)