Bosistoa transversa

J.F.Bailey & C.T.White · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Bosistoa

At a glance

Occurrence records399

Data sources9

Biological traits32

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Bosistoa transversa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility399 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF399 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Foliage in Coffs Harbour Botanical Garden Bosistoa transversa, commonly known as the yellow satinheart, or three-leaved bosistoa, is a species of small to medium-sized rainforest tree that is endemic to eastern Australia. It has mostly pinnate leaves, usually with three leaflets and panicles of small white flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology13

Fruit length12 mm

Fruit width11.5 mm

Leaf length105 mm

Leaf length max160 mm

Leaf length min85 mm

Leaf width42.5 mm

Leaf width max60 mm

Leaf width min10 mm

Petiole length1.2 cm

Plant height22 m

Plant height max15 m

Seed length10 mm

Seed width7 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timennyyynnnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical obovate orbicular ovate widely_elliptical

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density839 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Bosistoa transversa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acridone alkaloids10

Lupane triterpenoids1

Ursane and Taraxastane triterpenoids1

Cholestane steroids $ Stigmastane steroids1

Cinnamic acid amides1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
1,3,5-Trihydroxy-2-(2-hydroxy-3-methylbut-3-enyl)-10-methyl-4-(3-methylbut-2-enyl)acridin-9-one	present	LOTUS
1,3,5-trihydroxy-2-[(1R)-1-hydroxy-3-methylbut-3-enyl]-10-methyl-4-(3-methylbut-2-enyl)acridin-9-one	present	LOTUS
1,3,5-trihydroxy-2-[(2R)-2-hydroxy-3-methylbut-3-enyl]-10-methyl-4-(3-methylbut-2-enyl)acridin-9-one	present	LOTUS
1,3,5-trihydroxy-2-[(2R)-2-hydroxy-3-methylbut-3-enyl]-10-methylacridin-9-one	present	LOTUS
1,5-Dihydroxy-3-methoxy-10-methylacridin-9-one	present	LOTUS
1-[5-Hydroxy-8-(2-hydroxypropan-2-yl)-2,2-dimethyl-8,9-dihydrofuro[2,3-h]chromen-6-yl]ethanone	present	LOTUS
5,10-dihydroxy-12-[(2R)-2-hydroxy-3-methylbut-3-enyl]-2,2,11-trimethylpyrano[3,2-b]acridin-6-one	present	LOTUS
7H-Pyrano[2,3-c]acridin-7-one, 3,12-dihydro-6,11-dihydroxy-3,3,12-trimethyl-5-(3-methyl-2-butenyl)-	present	LOTUS
beta-Amyrin	present	LOTUS
Braylin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bosistoa transversa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN082853.1 ↗760 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACTCGTGAAAACACCGGAG …

Bosistoa transversa voucher CBG 8604257 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type399 records

Wild obs. + sensor139

Museum / vouchered224

Cultivated / captive2

Other34

Origin

Native23

Range

Area of Occupancy AOO668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 108≤1 km 14≤10 km 2>10 km 4

128 georeferenced · 11 without coordinates

Open the mapobservation + sensor139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 60≤1 km 36≤10 km 91>10 km 18

205 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence224

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	105
Canberra, AU	49
Mount Annan, AU	23
Museo Entomologico de Leonlocation not on record	13
Smithfield, AU	12
Armidale, AU	9
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Palmerston, AU	2
Kensington, AU	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Adelaide, AU	1
AUAlocation not on record	1

12 institutions · 222 of 224 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Bosistoa transversa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter6.60 °C

Max temp (day)25.7 °C

Min temp (night)24.2 °C

Precipitation163 mm/mo

Air humidity60.0 %

Vapour deficit1,264 Pa

Cloud cover34.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)