Bosistoa pentacocca

(F.Muell.) Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Bosistoa

At a glance

Occurrence records135

Data sources10

Biological traits34

DNA specimens6

eDNA detections2

Sources10 archives

Databases and archives Bosistoa pentacocca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS · NPASS33 compounds

Occurrence & distributionGBIF135 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Bosistoa pentacocca, commonly known as ferny-leaf bosistoa, native almond or union nut, is a species of tree that is endemic to eastern Australia. It has pinnate leaves arranged in opposite pairs with between three and thirteen leaflets and panicles of small flowers arranged in leaf axils or on the ends of branches. It grows along streams in rainforest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length21 mm

Fruit width20 mm

Leaf length205 mm

Leaf length max450 mm

Leaf length min140 mm

Leaf mass per area94.1 g/m2

Leaf size15 976 mm²

⚠ sources differ — TRY: 15 976 mm² · AusTraits: 22 807 mm²

Leaf width42.5 mm

Leaf width max70 mm

Leaf width min15 mm

Petiole length5.5 cm

Plant height18 m

Plant height max18 m

Seed length13.5 mm

Seed width10 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timenynnnnnnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical narrowly_elliptical oblanceolate oblong obovate widely_elliptical

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)10.63 mm²/mg

Wood density710 mg/cm³

03Chemical composition33 compounds

Compounds documented for Bosistoa pentacocca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Trichothecane sesquiterpenoids9

Prenylated,geranylated phloroglucinols4

Miscellaneous meroterpenoids2

Cholestane steroids1

Stigmastane steroids1

Documented compounds33 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4S)-4-[(1R,4R)-4-hydroxy-2-(hydroxymethyl)-1-methylcyclopent-2-en-1-yl]-1,4-dimethylcyclohex-2-en-1-ol	present	NPASS
(3S,4R,7R)-4-[(1S,4S)-4-hydroxy-1,4-dimethylcyclohex-2-en-1-yl]-4-methyl-1-oxaspiro[2.4]heptan-7-ol	present	NPASS
(4S)-4-((1R,2S)-2-Hydroxy-1,4-dimethyl-3-cyclohexen-1-yl)-3-(hydroxymethyl)-4-methyl-2-cyclopenten-1-one	present	NPASS
15-Hydroxytrichodiene	present	NPASS
4,15-Bis(acetyloxy)-12,13-epoxy-3-hydroxytrichothec-9-en-8-one (3alpha,4beta)-	present	NPASS
8-acetoxy T-2 tetraol	present	NPASS
8Alpha-Hydroxysambucoin	present	NPASS
8Beta-Hydroxysambucoin	present	NPASS
[(3S,5R,10S,11S,12S,13R,17R)-3,11-dihydroxy-4,4,10,13-tetramethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-1,2,3,5,6,7,11,12,16,17-decahydrocyclopenta[a]phenanthren-12-yl] acetate	present	NPASS
[2-(3,7-Dimethylocta-2,6-dienyl)-3,5-dihydroxy-6-(3-methylbut-2-enyl)phenyl] acetate	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bosistoa pentacocca has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895741.1 ↗504 bpAustralia

ACGT

ACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGAGGAAGCGGGGGCT …

Bosistoa pentacocca voucher 1076420323 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type135 records

Wild obs. + sensor31

Museum / vouchered86

Other18

Origin

Native2

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 1≤10 km 1>10 km 3

14 georeferenced · 17 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 3≤1 km 35≤10 km 32>10 km 3

73 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	39
Smithfield, AU	28
Museo Entomologico de Leonlocation not on record	5
Armidale, AU	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Kew, GB	2
Mount Annan, AU	2

7 institutions · 82 of 86 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Bosistoa pentacocca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 18.6–19.3

Seasonal swing summer↔winter10.9 °C

Max temp (day)24.6 °C 24.1–25.1

Min temp (night)14.0 °C 13.9–14.2

Precipitation88.2 mm/mo 74.2–102

Air humidity58.8 % 57.2–60.5

Moisture balance-31.6 mm/mo -45.4–-17.8

Vapour deficit911 Pa 849–972

Wind speed3.10 m/s 3.00–3.30

Cloud cover25.6 % 24.1–27.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)