Bosistoa medicinalis

(F.Muell.) T.G.Hartley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Bosistoa

At a glance

Occurrence records452

Data sources9

Biological traits19

DNA specimens9

eDNA detections4

Sources9 archives

Databases and archives Bosistoa medicinalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility452 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF452 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Flower detail Bosistoa medicinalis, commonly known as the northern towra or Eumundi bosistoa, is a species of small to medium-sized rainforest tree that is endemic to Queensland. It has simple and pinnate leaves with two or three leaflets and panicles of small white flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology8

Fruit length10.5 mm

Fruit width9 mm

Leaf length105 mm

Leaf width37.5 mm

Petiole length0.8 cm

Plant height20 m

Seed length8 mm

Seed width5.5 mm

Life cycle & reproduction4

Flowering timeyyyyyynnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climateseasonally dry tropical

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

Leaf compoundnesscompound simple

Leaf shapeobovate orbicular ovate

Woodinesswoody

03Chemical composition10 compounds

Compounds documented for Bosistoa medicinalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols4

Flavanones3

Multiflorane triterpenoids1

Bauerane triterpenoids1

Flavanones $ Flavonostilbenes1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-5,7-dihydroxy-2-(4-methoxyphenyl)-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	LOTUS
(2R)-6-[[(2S)-5,7-dihydroxy-2-(4-methoxyphenyl)-4-oxo-2,3-dihydrochromen-8-yl]methyl]-5,7-dihydroxy-2-(4-methoxyphenyl)-8-(3-methylbut-2-enyl)-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-5,7-dihydroxy-8-(2-hydroxy-3-methylbut-2-enyl)-2-(4-methoxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(3beta,13alpha,14beta)-13-Methyl-26-norurs-7-en-3-ol	present	LOTUS
5,7-Dihydroxy-3-methoxy-2-(3-methoxy-4-((3-methyl-2-butenyl)oxy)phenyl)-4H-1-benzopyran-4-one	present	LOTUS
5,7-Dihydroxy-3-methoxy-4'-prenyloxyflavone	present	LOTUS
Jaranol	present	LOTUS
Multiflorenol	present	LOTUS
Pachypodol	present	LOTUS
Tsugafolin	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bosistoa medicinalis has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ225788.1 ↗426 bp

ACGT

GGATCGCGGCGACGCGGGCGGTTCGCTGCCTGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAA …

Bosistoa medicinalis isolate 285 internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type452 records

Wild obs. + sensor11

Museum / vouchered370

Other71

Origin

Native16

Range

Area of Occupancy AOO664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 4

6 georeferenced · 5 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 81≤1 km 104≤10 km 122>10 km 19

326 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence370

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	136
Smithfield, AU	100
Canberra, AU	45
Museo Entomologico de Leonlocation not on record	33
Mount Annan, AU	16
Kew, GB	7
James Cook Townsvillelocation not on record	6
Palmerston, AU	6
Australian Tropical Herbariumlocation not on record	2
Adelaide, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Honolulu, US	1
Armidale, AU	1

13 institutions · 356 of 370 vouchered records shown · 13 without an institution code

09Environmental DNA4 detections

Where the DNA of Bosistoa medicinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 11.4–22.8

Seasonal swing summer↔winter11.0 °C

Max temp (day)23.1 °C 15.2–27.9

Min temp (night)12.6 °C 7.80–18.3

Precipitation70.5 mm/mo 23.4–282

Air humidity58.7 % 47.4–66.9

Moisture balance5.80 mm/mo -105–157

Vapour deficit785 Pa 554–1,395

Wind speed3.20 m/s 2.30–3.90

Cloud cover23.8 % 14.0–53.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)