Bombus polaris

Curtis, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Bombus

At a glance

Occurrence records2 249

Data sources10

Biological traits0

DNA specimens114

eDNA detections120

Sources10 archives

Databases and archives Bombus polaris's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 249 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI120 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics114 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 249 records

Environmental DNA1 datasets · 3 countries120 detections

DNA & barcodingBOLD114 specimens

Genome at a glanceGoaT · NCBI≈246 Mbp

01Narrative

Bombus polaris is a common Arctic bumblebee species. B. polaris is one of two bumblebees that live above the Arctic Circle. The other is its social parasite Bombus hyperboreus. B. polaris is a social bee that can survive at near freezing temperatures. It has developed multiple adaptations to live in such cold temperatures. B. polaris has a thicker coat of hair than most bees, utilizes thermoregulation, and makes insulated nests.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding114 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bombus polaris has left across the world's sequence archives.

At a glance

DNA specimens114

BINs2

Marker genes2

eDNA detections120

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus108 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

13Tmostly conserved

309Cmostly conserved

346Gvariable

403Gmostly conserved

AATAATATATTTTATTTTTGCTATATGATCAGGAATAATTGGTTCATCAATAAGTTTATTAATTCGAATGGAATTAAGACATCCTGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes14

BINs2

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bombus pyrrhopygussame genus2.1%Bombus kirbiellussame genus5.3%Bombus balteatussame genus5.6%Bombus alpinussame genus5.8%Bombus neoboreussame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Bombus polaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈245 790 074 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Bombus polaris0.25 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95% BUSCO

08Occurrence & distribution

Record type2 249 records

Wild obs. + sensor52

Museum / vouchered2 197

Range

Area of Occupancy AOO1 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 23≤1 km 13≤10 km 10>10 km 1

47 georeferenced · 5 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 987≤1 km 178≤10 km 144>10 km 84

1 393 georeferenced · 804 without coordinates

Open the institutions mapphysical evidence2 197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	1 207
CNClocation not on record	410
Washington, US	249
Anchorage, US	87
New Haven, US	49
Cambridge, US	39
Beltsville, US	35
Champaign, US	26
MZLUlocation not on record	22
East Lansing, US	11
Vancouver, CA	9
Wuzhou, CN	7
Essig Museum of Entomologylocation not on record	7
Colorado State Universitylocation not on record	5
	4
Stockholm, SE	3
Copenhagen, DK	3
UCRClocation not on record	2
WIlocation not on record	1
US	1
Chicago, US	1
University of Alaska Museumlocation not on record	1
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	1

23 institutions · 2 180 of 2 197 vouchered records shown · 17 without an institution code

09Environmental DNA120 detections

Where the DNA of Bombus polaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found120

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 120 detections have coordinates

Open the map3 countries0

sand dune, Dianthus repensMixed habitattundraarctic alpineforb meadow17. Other

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.90 °C -27.0–13.5

Seasonal swing summer↔winter37.0 °C

Max temp (day)12.1 °C -24.2–18.1

Min temp (night)5.60 °C -30.2–9.40

Precipitation78.5 mm/mo 20.0–135

Air humidity61.8 % 56.8–81.7

Moisture balance4.90 mm/mo -55.7–42.4

Vapour deficit421 Pa 20.6–704

Wind speed4.40 m/s 2.40–9.10

Cloud cover48.9 % 39.0–68.0

CHELSA 1981–2010, ~9 km grid, at location & month of 108 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Bombus polaris

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 249 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 249 records