Boletus speciosus

Frost · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Boletus

At a glance

Occurrence records179

Data sources9

Biological traits0

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Boletus speciosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility179 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF179 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceGoaT · NCBI38 Mbp

01Narrative

Boletus speciosus Frost, 1874 è un fungo basidiomicete della famiglia Boletaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Boletus speciosus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ882204.1 ↗718 bpUSA

ACGT

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATTCTGAGGGGGAAGACGGAGGAGTGAAGATT …

Boletus speciosus voucher 20569 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Boletus speciosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size37 590 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Boletus speciosus0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness85.8% BUSCO

08Occurrence & distribution

Record type179 records

Wild obs. + sensor50

Museum / vouchered126

Other3

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 3≤1 km 2≤10 km 28>10 km 5

38 georeferenced · 12 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 15≤10 km 40>10 km 5

63 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	16
TENN-Flocation not on record	11
Chapel Hill, US	10
Acadia Universitylocation not on record	9
Bronx, US	9
Blacksburg, US	8
Ann Arbor, US	6
Chicago, US	5
Bando, JP	5
Nagatoro-machi, Chichibu-gun, JP	4
Tomioka, JP	4
FLASlocation not on record	4
Catholic University of Pekinglocation not on record	3
Davis and Elkins Collegelocation not on record	3
Osaka, JP	2
Burlington, US	2
BDBClocation not on record	2
Durham, US	2
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1
WTUlocation not on record	1
San Sebastián, ES	1
Champaign, US	1
ILLSlocation not on record	1
Odawara, JP	1
MAlocation not on record	1
Karlsruhe, DE	1
Zürich, CH	1
Ciudad de México, MX	1

28 institutions · 115 of 126 vouchered records shown · 7 without an institution code

09Environmental DNA7 detections

Where the DNA of Boletus speciosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 13.1–19.2

Seasonal swing summer↔winter11.4 °C

Max temp (day)20.4 °C 18.8–21.5

Min temp (night)10.9 °C 8.00–14.6

Precipitation144 mm/mo 38.0–233

Air humidity63.4 % 51.9–69.7

Moisture balance36.2 mm/mo -90.0–125

Vapour deficit714 Pa 657–806

Wind speed3.30 m/s 2.00–5.40

Cloud cover50.3 % 38.2–63.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)