Boletus chippewaensis

A.H.Sm. & Thiers · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Boletus

At a glance

Occurrence records339

Data sources8

Biological traits0

DNA specimens2

eDNA detections3

Sources8 archives

Databases and archives Boletus chippewaensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF339 records

Environmental DNA2 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈57 Mbp

01Narrative

Boletus chippewaensis, de son nom vernaculaire en français Bolet du Chippewa et plus généralement Cèpe d'Amérique est un champignon basidiomycètes comestible de la région du Michigan. C'est un cèpe du genre Boletus de la famille des Boletaceae, Classé dans le groupe de Boletus edulis, une analyse phylogénétique récente a précisé qu'il s'agit d'une espèce différente de Boletus edulis et pas d'une variété, mais classée dans le clade de Boletus edulis sensu stricto.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Boletus chippewaensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences9

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN992302.1 ↗483 bpCanada · 2015

ACGT

CACCCTTTGTAGGCCCTCGAAAGAGGATCTACGTTTTCTCTATATACGCTTTTTGCTACGCATGTCCAGAATGTATACAAACTTTACAAC …

Boletus chippewaensis voucher ANT301-QFB28833 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Boletus chippewaensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈56 841 418 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Boletus chippewaensis0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type339 records

Wild obs. + sensor304

Museum / vouchered35

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 93≤1 km 42≤10 km 66>10 km 68

269 georeferenced · 35 without coordinates

Open the mapobservation + sensor304

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 6≤10 km 7>10 km 1

14 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Montréal Biodiversity Centrelocation not on record	17
Toronto, CA	12
Rene Pomerleau Herbariumlocation not on record	2
US	1
Chicago, US	1

5 institutions · 33 of 35 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Boletus chippewaensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Pessiere blanchePessiere noire

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 11.2–11.2

Seasonal swing summer↔winter25.0 °C

Max temp (day)12.5 °C

Min temp (night)10.4 °C

Precipitation92.3 mm/mo

Air humidity62.2 %

Moisture balance8.30 mm/mo

Vapour deficit504 Pa

Wind speed5.30 m/s

Cloud cover60.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)