Bolbitis auriculata

(Lam.) Alston · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Dryopteridaceae/Bolbitis

At a glance

Occurrence records443

Data sources7

Biological traits9

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Bolbitis auriculata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility443 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF443 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Bolbitis labrusca là một loài dương xỉ trong họ Dryopteridaceae. Loài này được Ching in C.Chr. mô tả khoa học đầu tiên năm 1934. Danh pháp khoa học của loài này chưa được làm sáng tỏ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formperennial or lithophyte

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bolbitis auriculata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLEF040664.1 ↗940 bpMauritius

ACGT

AGTCCCGTTTGTGGTGACATGGGTTTGCTCCTCCCTATGACTAAATTGGTAAATCTTGCAAAGATGAGATCTGCTCGGCATAGGTAGAGT …

Bolbitis auriculata voucher Rouhan 101 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; rbcL-atpB intergenic spacer, complete sequence; and AtpB (atpB) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

08Occurrence & distribution

Record type443 records

Wild obs. + sensor94

Museum / vouchered348

Other1

Range

Area of Occupancy AOO720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 71≤10 km 15>10 km 6

92 georeferenced · 2 without coordinates

Open the mapobservation + sensor94

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 2≤10 km 11>10 km 1

14 georeferenced · 334 without coordinates

Open the institutions mapphysical evidence348

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	37
Paris, FR	31
Kew, GB	20
MeiseBGlocation not on record	19
Université du Lomélocation not on record	17
Plocation not on record	15
BRLUlocation not on record	14
LBVlocation not on record	14
Yaoundé, CM	13
WAGlocation not on record	9
CNF-UFHBlocation not on record	9
Brussels, BE	8
IPHAMETRAlocation not on record	6
Herbier National du Gabonlocation not on record	4
Llocation not on record	3
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	3
Chicago, US	3
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	3
Institut Botanique Ake-Assi d'Andokoilocation not on record	2
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Minia, EG	1
Cape Town, ZA	1
Frankfurt am Main	1
Miami, US	1
Université Nangui Abrogoualocation not on record	1
Wuzhou, CN	1
Philadelphia, US	1
Edinburgh, GB	1
MAlocation not on record	1
Coimbra, PT	1
National Institute of Hygienic Scienceslocation not on record	1
Chapel Hill, US	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
EAlocation not on record	1

35 institutions · 247 of 348 vouchered records shown · 101 without an institution code

09Environmental DNA1 detections

Where the DNA of Bolbitis auriculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)