Blandfordia cunninghamii

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Blandfordiaceae/Blandfordia

At a glance

Occurrence records127

Data sources8

Biological traits29

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Blandfordia cunninghamii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF127 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Blandfordia cunninghamii est une espèce de plantes monocotylédones de la famille des Blandfordiaceae. C'est l'une des quatre espèces de plantes à fleurs communément appelées cloches de Noël. Il s'agit d'une pérenne touffue. herbe endémique des régions des Blue Mountains et de l'Illawarra de l'Est de l'Australie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology7

Fruit length90 mm

Leaf length1 000 mm

Leaf length max1 000 mm

Leaf width9.5 mm

Leaf width max12 mm

Leaf width min7 mm

Seed mass1.21 mg

Life cycle & reproduction9

Dehiscencedehiscent

Flowering timeyynnnnnnnnny

Life formtuberous geophyte

Life spanperennial

Pollination syndromebird+insect

Raunkiær life formcryptophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Blandfordia cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLMZ047957.1 ↗1 323 bp

ACGT

GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTTCCGCCTGAAGAAGCAGGGGCAGCGGTAGCTGCCGAATCTTCT …

Blandfordia cunninghamii voucher JLB355 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Blandfordia cunninghamii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 541×CCDB · book-fedorov

CCDB · book-fedorov — Briggs (Di Fulvio, Cave 19ti4)

08Occurrence & distribution

Record type127 records

Wild obs. + sensor89

Museum / vouchered36

Cultivated / captive2

Origin

Native18

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 55≤1 km 10≤10 km 3>10 km 7

75 georeferenced · 14 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 6≤1 km 11≤10 km 14>10 km 2

33 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence36

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	18
NSW Dept of Planning, Industry and Environmentlocation not on record	7
Armidale, AU	2
Canberra, AU	2
Museo Entomologico de Leonlocation not on record	2
Adelaide, AU	1
Kew, GB	1
John T. Waterhouse Herbariumlocation not on record	1
Brisbane, AU	1
Wollongong, AU	1

10 institutions · 36 of 36 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Blandfordia cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)