Biscogniauxia marginata

(Fr.) Pouzar · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Xylariales/Graphostromataceae/Biscogniauxia

At a glance

Occurrence records1 375

Data sources10

Biological traits0

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Biscogniauxia marginata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 375 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS11 compounds

Occurrence & distributionGBIF1 375 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈46 Mbp

01Narrative

Biscogniauxia marginata is a species of fungus in the family Xylariaceae. A plant pathogen, it was given its current name by Czech mycologist Zdeněk Pouzar in 1979.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition11 compounds

Compounds documented for Biscogniauxia marginata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Daphnane diterpenoids3

Furanoid lignans2

Arylnaphthalene and aryltetralin lignans1

Furofuranoid lignans1

Fatty alcohols1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Episesaminone	present	NPASS
(-)-Lariciresinol	present	NPASS
1-Octacosanol	present	NPASS
[(1R,2R,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,23S,25R)-10,11-dihydroxy-9-(hydroxymethyl)-2,13,15-trimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-12-yl] benzoate	present	NPASS
[(1R,2R,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15S,23S,25R)-10,11-dihydroxy-9-(hydroxymethyl)-2,13,15-trimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-12-yl] benzoate	present	NPASS
Cyclolariciresinol	present	NPASS
Epipinoresinol	present	NPASS
Gnidilatidin	present	NPASS
HACVLIGOURPYLV-SVOQZPEWSA-N	present	NPASS
IDASJTBLBSIWHG-CABCVRRESA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Biscogniauxia marginata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKJ958407.1 ↗531 bpFrance · 2012

ACGT

GGGATCATTAGCGAGTTACTGGAAAACTCCAAACCCCTGTGAATATACCTATTGTTGCCTCGGCAGGCTGTGCTGTCTGGTAGCTCCTAC …

Biscogniauxia marginata isolate MFLUCC 12-0740 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Biscogniauxia marginata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈45 592 449 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Biscogniauxia marginata0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 375 records

Wild obs. + sensor1 066

Museum / vouchered309

Range

Area of Occupancy AOO3 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 560≤1 km 92≤10 km 213>10 km 10

875 georeferenced · 191 without coordinates

Open the mapobservation + sensor1 066

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 26≤1 km 44≤10 km 186>10 km 12

268 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	177
GJOlocation not on record	21
WU-MYClocation not on record	18
SLU Artdatabankenlocation not on record	12
Olocation not on record	12
Chicago, US	7
Catholic University of Pekinglocation not on record	6
Copenhagen, DK	6
nsnflocation not on record	5
TROMlocation not on record	5
BDBClocation not on record	4
Pullman, US	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Bronx, US	3
Göteborg, SE	3
Görlitz, DE	2
Trondheim, NO	2
Museo Entomologico de Leonlocation not on record	1
Tartu, EE	1
San Sebastián, ES	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Yerevan, AM	1
Uppsala, SE	1
DPIlocation not on record	1

24 institutions · 298 of 309 vouchered records shown · 10 without an institution code

09Environmental DNA2 detections

Where the DNA of Biscogniauxia marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter15.8 °C

Max temp (day)14.0 °C

Min temp (night)5.10 °C

Precipitation76.5 mm/mo

Air humidity60.3 %

Moisture balance-13.1 mm/mo

Vapour deficit487 Pa

Wind speed4.80 m/s

Cloud cover39.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Biscogniauxia marginata

At a glance

Sources10 archives

Compound class profile5 classes

Documented compounds11 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 375 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 375 records