Biscogniauxia atropunctata

(Schwein.) Pouzar · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Xylariales/Graphostromataceae/Biscogniauxia

At a glance

Occurrence records3 199

Data sources7

Biological traits0

DNA specimens2

eDNA detections5

Sources7 archives

Databases and archives Biscogniauxia atropunctata's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF3 199 records

Environmental DNA2 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Biscogniauxia atropunctata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ632349.1 ↗555 bp

ACGT

CAGCGGAGGGATCATTAGCGAGTTAATTACAAGCTCCAAACCCATGTGAACATACCTACTGTTGCCTCGGCAGGCCGTGGCGCGCGGAAG …

Biscogniauxia atropunctata voucher Biscogniauxia_atropunctata_4324_1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type3 199 records

Wild obs. + sensor3 096

Museum / vouchered103

Range

Area of Occupancy AOO7 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 551≤1 km 419≤10 km 128>10 km 166

2 264 georeferenced · 832 without coordinates

Open the mapobservation + sensor3 096

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 1≤1 km 15≤10 km 7>10 km 2

25 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	39
Chicago, US	39
Colorado State Universitylocation not on record	6
Champaign, US	5
ILLSlocation not on record	3
Denver, US	2
Pullman, US	2
Chapel Hill, US	1
University of Tennessee at Chattanoogalocation not on record	1
WU-MYClocation not on record	1
St. Paul, US	1
Copenhagen, DK	1

12 institutions · 101 of 103 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Biscogniauxia atropunctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter27.4 °C

Max temp (day)29.0 °C

Min temp (night)21.8 °C

Precipitation315 mm/mo

Air humidity65.5 %

Moisture balance181 mm/mo

Vapour deficit1,140 Pa

Wind speed2.10 m/s

Cloud cover43.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Biscogniauxia atropunctata

At a glance

Sources7 archives

At a glance

Record type3 199 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 199 records