Bipolaris sorokiniana

Shoemaker · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Bipolaris

At a glance

Occurrence records470

Data sources12

Biological traits0

DNA specimens273

eDNA detections280

Sources12 archives

Databases and archives Bipolaris sorokiniana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI280 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics273 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS93 compounds

Occurrence & distributionGBIF470 records

Environmental DNA4 datasets · 8 countries280 detections

DNA & barcodingBOLD · NCBI273 specimens

Genome at a glanceGoaT · NCBI33 Mbp

01Narrative

The fungus Cochliobolus sativus is the teleomorph (sexual stage) of Bipolaris sorokiniana (anamorph) which is the causal agent of a wide variety of cereal diseases. The pathogen can infect and cause disease on roots (where it is known as common root rot), leaf and stem, and head tissue. C. sativus is extremely rare in nature and thus it is the asexual or anamorphic stage which causes infections. The two most common diseases caused by B. sorokiniana are spot blotch and common root rot, mainly on wheat and barley crops.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition93 compounds

Compounds documented for Bipolaris sorokiniana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Sativane sesquiterpenoids24

Flavonols13

Eudesmane sesquiterpenoids12

Flavones8

Anthraquinones and anthrones6

Documented compounds93 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,3R,4R,7S,8R,9R)-7-methyl-10-methylidene-4-propan-2-yltricyclo[5.2.1.03,8]decane-2,9-diol	present	LOTUS
(1R,3aS,4R,8aR)-Decahydro-4,8,8-trimethyl-9-methylene-1,4-methanoazulene	present	LOTUS
(1R,3E,5R,8E,12E,15S)-5,17-dihydroxy-18-[(2S)-1-hydroxypropan-2-yl]-4,8,12,15-tetramethylbicyclo[13.3.0]octadeca-3,8,12,17-tetraen-16-one	present	LOTUS
(1R,3R,4S,7S,8S,9R)-1-methyl-2-methylidene-9-propan-2-yl-5-oxatricyclo[5.4.0.03,8]undecan-4-ol	present	LOTUS
(1R,4R,5S,8S)-1,7-Dimethyl-4-(1-methylethyl)bicyclo(3.2.1)oct-6-ene-6,8-dicarboxaldehyde	present	LOTUS
(1R,4R,5S,8S)-1,7-Dimethyl-4-(propan-2-yl)bicyclo[3.2.1]oct-6-ene-6,8-dicarboxylic acid	present	LOTUS
(1S,2R,3R,4S,7R,8S,9S)-4-(2-hydroxypropan-2-yl)-7-methyl-10-methylidenetricyclo[5.2.1.03,8]decane-2,9-diol	present	LOTUS
(1S,3aS,4R,8aS)-1-hydroxy-4,8a-dimethyl-1,2,3,3a,4,5,7,8-octahydroazulen-6-one	present	NPASS
(1S,4R,5R,8R)-8-(hydroxymethyl)-1,7-dimethyl-4-propan-2-ylbicyclo[3.2.1]oct-6-ene-6-carbaldehyde	present	LOTUS
(1S,6R,9R)-6-methyl-2,10-dimethylidene-12-oxatricyclo[7.3.1.01,6]tridecan-11-one	present	NPASS

05DNA & barcoding273 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bipolaris sorokiniana has left across the world's sequence archives.

At a glance

DNA specimens273

Marker genes4

GenBank sequences10

eDNA detections280

Countries19

The DNA barcodea real sequence read deposited for this species

ITSPZ367827.1 ↗503 bpIraq · 2025

ACGT

CGGCTGAATATTTTTTTCACCCTGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACCTTTT …

Bipolaris sorokiniana isolate B.Karma 2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Bipolaris sorokiniana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size33 210 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Bipolaris sorokiniana0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–82n range7median6mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 61×GoaT · Wioletta Wieloch 2006

GoaT · Wioletta Wieloch 2006 — ↗

2n 71×GoaT · Wioletta Wieloch 2006

GoaT · Wioletta Wieloch 2006 — ↗

2n 81×GoaT · Wioletta Wieloch 2006

GoaT · Wioletta Wieloch 2006 — ↗

2n 151×GoaT · Wioletta Wieloch 2006

GoaT · Wioletta Wieloch 2006 — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type470 records

Wild obs. + sensor2

Museum / vouchered445

Cultivated / captive22

Other1

Range

Area of Occupancy AOO756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 3≤10 km 80>10 km 13

96 georeferenced · 349 without coordinates

Open the institutions mapphysical evidence445

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the mapnot free-living22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	81
Bronx, US	25
Bernard Price Institute for Palaeontological Researchlocation not on record	8
Catholic University of Pekinglocation not on record	6
Pullman, US	2
Laboratorio de Ictiologialocation not on record	2
Auckland, NZ	1
Uppsala, SE	1
St. Paul, US	1

9 institutions · 127 of 445 vouchered records shown · 286 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA280 detections

Where the DNA of Bipolaris sorokiniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found280

Studies independent surveys4

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 280 detections have coordinates

Open the map8 countries0

barley fieldleaves

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.55 4.50–7.50

Conductivity117 µS/cm 51.0–2,129

Organic carbon2.79 % 0.65–4.77

Water content12.5 % 8.56–21.6

Nitrate-N7.00 mg/kg 1.00–16.0

Phosphorus31.0 mg/kg 6.00–99.0

Clay24.1 % 3.95–38.0

Sand57.9 % 46.1–94.0

Depth0 m 0–0.2

SoilSodosolTenosolsChromosolsKurosols

10 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 7.40–25.1

Seasonal swing summer↔winter17.6 °C

Max temp (day)21.1 °C 9.60–30.5

Min temp (night)10.9 °C 3.00–19.3

Precipitation68.8 mm/mo 19.4–344

Air humidity58.0 % 52.3–64.9

Moisture balance-19.2 mm/mo -85.2–263

Vapour deficit758 Pa 428–1,590

Wind speed2.90 m/s 1.80–4.50

Cloud cover25.4 % 15.3–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)