Bipolaris oryzae

(Breda de Haan) Shoemaker · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Bipolaris

At a glance

Occurrence records299

Data sources12

Biological traits0

DNA specimens145

eDNA detections151

Sources12 archives

Databases and archives Bipolaris oryzae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI151 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics145 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS70 compounds

Occurrence & distributionGBIF299 records

Environmental DNA2 datasets · 12 countries151 detections

DNA & barcodingBOLD · NCBI145 specimens

Genome at a glanceGoaT · NCBI31 Mbp

01Narrative

Cochliobolus miyabeanus (formerly known as Helminthosporium oryzae) is a fungus that causes brown spot disease in rice. It was considered for use by the USA as a biological weapon against Japan during World War II.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition70 compounds

Compounds documented for Bipolaris oryzae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ophiobolane sesterterpenoids18

Guaiane sesquiterpenoids8

Cycloartane triterpenoids4

Ascarosides4

Other polyketide meroterpenoids3

Documented compounds70 total

Tissue Source Quantified only

Compound	Amount	Source
(1'R,2S,3S,3'R,5R,7'R,11'R)-7'-hydroxy-1',3,4'-trimethyl-5-(2-methylprop-1-enyl)-6'-oxospiro[oxolane-2,12'-tricyclo[9.3.0.03,7]tetradeca-4,8-diene]-8'-carbaldehyde	present	LOTUS
(1'R,2S,3S,3'S,5R,7'R,11'R)-1',3,4'-trimethyl-5-(2-methylprop-1-enyl)-6'-oxospiro[oxolane-2,12'-tricyclo[9.3.0.03,7]tetradeca-4,8-diene]-8'-carbaldehyde	present	LOTUS
(1'R,2S,3S,3'S,5R,7'S,11'R)-1',3,4'-trimethyl-5-(2-methylprop-1-enyl)-6'-oxospiro[oxolane-2,12'-tricyclo[9.3.0.03,7]tetradeca-4,8-diene]-8'-carbaldehyde	present	LOTUS
(1R,2S,3'R,4R,6S,8R,9R,10R,12S,15R,20S,21R,23S)-21-hydroxy-2,3',8,10,19,19-hexamethylspiro[5,13,14,18-tetraoxahexacyclo[18.3.2.02,10.04,9.012,23.015,21]pentacosane-6,5'-oxolane]-2',17-dione	present	NPASS
(1R,3'R,4R,5R,6R,8S,10R,12S,13S,16R,21R,25R)-25-hydroxy-3',4,6,12,17,17-hexamethylspiro[9,18,22,23-tetraoxahexacyclo[14.7.2.01,13.04,12.05,10.021,25]pentacosane-8,5'-oxolane]-2',19-dione	present	NPASS
(1S,3'R,4R,5R,6R,8S,10R,12S,13S,16S,22S)-3',4,6,12,17,17-hexamethylspiro[9,18,23,24-tetraoxahexacyclo[20.2.1.01,13.04,12.05,10.016,22]pentacos-20-ene-8,5'-oxolane]-2',19-dione	present	NPASS
(2R,3R,5R,6S)-2-[(2R,28R)-28-hydroxynonacosan-2-yl]oxy-6-methyloxane-3,5-diol	present	NPASS
(2R,3R,5R,6S)-2-[(2S,30R)-30-hydroxyhentriacontan-2-yl]oxy-6-methyloxane-3,5-diol	present	NPASS
(2R,3R,5R,6S)-2-[(2S,32R)-32-hydroxytritriacontan-2-yl]oxy-6-methyloxane-3,5-diol	present	NPASS
(3S,3aS,6aR,9R,9aS,9bS)-9-hydroxy-9-(hydroxymethyl)-3-methyl-6-methylidene-3,3a,4,5,6a,7,9a,9b-octahydroazuleno[4,5-b]furan-2,8-dione	present	NPASS

05DNA & barcoding145 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bipolaris oryzae has left across the world's sequence archives.

At a glance

DNA specimens145

Marker genes4

GenBank sequences10

eDNA detections151

Countries16

The DNA barcodea real sequence read deposited for this species

ITSPZ429635.1 ↗534 bpIndia · 2023

ACGT

ACCTGCGGAGGGATCATTACACAACAAAATATGAAGGCCTGGCTTTCGCGGCCGGCTGAAGTATTTTTTTCACCCATGTCTTTTGCGCAC …

Bipolaris oryzae isolate BoWB-3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Bipolaris oryzae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size31 360 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Bipolaris oryzae0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type299 records

Wild obs. + sensor4

Museum / vouchered295

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤1 km 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence295

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Karlsruhe, DE	2
BDBClocation not on record	1

3 institutions · 5 of 295 vouchered records shown · 272 without an institution code

09Environmental DNA151 detections

Where the DNA of Bipolaris oryzae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found151

Studies independent surveys2

Countries12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 151 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 9.80–28.2

Seasonal swing summer↔winter6.60 °C

Max temp (day)27.4 °C 12.0–35.6

Min temp (night)18.5 °C 5.40–23.1

Precipitation78.0 mm/mo 6.60–344

Air humidity56.1 % 45.1–64.9

Moisture balance-72.2 mm/mo -156–263

Vapour deficit1,267 Pa 502–2,043

Wind speed2.70 m/s 1.80–4.50

Cloud cover21.3 % 16.1–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)