Billaea triangulifera

(Zetterstedt, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Billaea

At a glance

Occurrence records247

Data sources7

Biological traits0

DNA specimens11

eDNA detections37

Sources7 archives

Databases and archives Billaea triangulifera's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility247 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF247 records

Environmental DNA3 datasets · 6 countries37 detections

DNA & barcodingBOLD11 specimens

01Narrative

Billaea rutilans is a species of bristle fly in the family Tachinidae. It is a parasitoid of larval Prionus coriarius beetles, piercing the beetle near its spiracles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Billaea triangulifera has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections37

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

1Avariable

49Tmostly conserved

79Amostly conserved

217Amostly conserved

220Cmostly conserved

229Amostly conserved

256Cmostly conserved

271Tmostly conserved

322Gmostly conserved

619Tvariable

653Tvariable

AACCTTATATTTTATTTTAGGAGCTTGATCAGGAATAATCGGAACATCTTTAAGTATTCTAATTCGAGCAGAATTAGGACACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes3

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Billaea irroratasame genus10.3%Pegoplata debilissame order10.4%Zeuxia cinereasame family11.3%Cryptomeigenia hineisame family11.7%Coenosia perpusillasame order11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type247 records

Wild obs. + sensor148

Museum / vouchered89

Other10

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 76≤1 km 40≤10 km 7>10 km 1

124 georeferenced · 24 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 61≤1 km 15≤10 km 2

78 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	19
NHMOlocation not on record	8
Helsinki, FI	7
Metsähallituslocation not on record	3
University of Tokyo, Department of Zoologylocation not on record	2
Provincia di Livornolocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Tampere Museum of Natural Historylocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

9 institutions · 43 of 89 vouchered records shown · 46 without an institution code

09Environmental DNA37 detections

Where the DNA of Billaea triangulifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys3

Countries6

Verifiable raw sequence linked23

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map6 countries0

1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 11.7–18.0

Seasonal swing summer↔winter20.3 °C

Max temp (day)18.7 °C 15.4–22.2

Min temp (night)11.0 °C 7.60–13.8

Precipitation90.8 mm/mo 63.2–131

Air humidity59.9 % 56.1–62.7

Moisture balance-12.7 mm/mo -65.6–38.2

Vapour deficit684 Pa 523–903

Wind speed2.80 m/s 2.10–3.80

Cloud cover47.2 % 37.4–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)