Bidens torta

Sherff · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Bidens

At a glance

Occurrence records62

Data sources10

Biological traits15

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Bidens torta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF62 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GIFT2n = 72

01Narrative

Bidens torta, the corkscrew beggarticks, is a flowering plant species in the family Asteraceae.ITIS Standard Report Page: Bidens torta Bidens torta is endemic to Hawaii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology8

Fruit length max10 mm

Fruit length min2.5 mm

Fruit width max1 mm

Fruit width min0.5 mm

Leaf length max300 mm

Leaf length min90 mm

Plant height max2.5 m

Plant height min1 m

Life cycle & reproduction2

Dehiscenceindehiscent

Life spanperennial

Habitat & environment5

Climberself-supporting

Epiphyteterrestrial

Fruit typeachene

Growth formSubshrub, Forb/herb

Woodinessnon-woody

03Chemical composition6 compounds

Compounds documented for Bidens torta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Chalcones6

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(E)-1-[2,3-dihydroxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-3-(3,4-dimethoxyphenyl)prop-2-en-1-one	present	LOTUS
(E)-1-[2,3-dihydroxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-3-(3-hydroxy-4-methoxyphenyl)prop-2-en-1-one	present	LOTUS
(E)-3-(3,4-dimethoxyphenyl)-1-[2-hydroxy-3-methoxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]prop-2-en-1-one	present	LOTUS
2-Propen-1-one,3-(3,4-dimethoxyphenyl)-1-(2-hydroxy-3,4-dimethoxyphenyl)-	present	LOTUS
[6-[2,3-Dihydroxy-4-[3-(3-hydroxy-4-methoxyphenyl)prop-2-enoyl]phenoxy]-3,4,5-trihydroxyoxan-2-yl]methyl acetate	present	LOTUS
Okanin 3,4,3',4'-tetramethyl ether	present	LOTUS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bidens torta has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU736438.1 ↗628 bp

ACGT

CCCTGCAATAGCAGAACGACTCGTGAACATGTACTTACACCTGGCTTTGCGAGGACCGAAGCTCTTGTTTTGAGCCTTGTAAAGCCTCGT …

Bidens torta internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GIFT

The complete instruction manual Bidens torta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 721×GIFT · GIFT (floras)

GIFT · GIFT (floras)

n 361×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GILLETT, G.W., & E.K.S. LIM. 1970. An experimental study of the genus Bidens (Asteraceae) in the Hawaiian Islands. Univ. Calif. Publ. Bot. 56: 1-63.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type62 records

Wild obs. + sensor40

Museum / vouchered22

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 16≤1 km 1≤10 km 1>10 km 16

34 georeferenced · 6 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 3≤1 km 4≤10 km 2

9 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	9
BISHlocation not on record	8
Bronx, US	1
Miami, US	1
HAWlocation not on record	1
Honolulu, US	1
Bloomington, US	1

7 institutions · 22 of 22 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)