Berberis vulgaris
speciesAt a glance
Occurrence records131 523
Data sources14
Biological traits56
DNA specimens24
eDNA detections14
Sources14 archives
Databases and archives Berberis vulgaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility131 523 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources56 traits
Chemical compositionLOTUS · NPASS92 compounds
Occurrence & distributionGBIF131 523 records
Environmental DNA1 datasets · 5 countries14 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB · GoaT · NCBI1.6 Gbp
01Narrative
L’épine-vinette commune ou le vinettier est une espèce de plantes à fleurs de la famille des berbéridacées. C'est un arbuste originaire de l'Ancien Monde et introduite ailleurs comme plante ornementale. En France, à partir du XIXe siècle, l'épine-vinette a été fréquemment éradiquée car c'est un hôte intermédiaire dans le cycle de la rouille noire du blé, un champignon pathogène des céréales. Cependant elle reste présente dans les zones de coteaux calcaires d'une grande moitié nord de la France.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology19
Fruit length10.5 mm
⚠ sources differ — AusTraits: 10.5 mm · GIFT: 9.9 mm
Fruit width5.5 mm
Leaf length40 mm
Leaf length max25 mm
Leaf length min10 mm
Leaf size279 mm²
⚠ sources differ — TRY: 279 mm² · LEDA: 351 mm² · GIFT: 278 mm²
Leaf width16.5 mm
Petiole length0.8 cm
Plant height1.92 m
⚠ sources differ — GIFT: 1.92 m · AusTraits: 2.75 m · LEDA: 1.75 m · TRY: 1.34 m
Plant height generative1.64 m
Plant height max4 m
Plant height min1 m
Seed length5 mm
Seed mass11.9 mg
⚠ sources differ — TRY: 11.9 mg · LEDA: 11.88 mg · GIFT: 25.67 mg
Seed mass max23.66 mg
Seed mass min9.9 mg
Seed volume20 mm³
Seed volume max20 mm³
Seed volume min20 mm³
Life cycle & reproduction13
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startMay
Life formshrub
Life spanperennial
Lifespan years9 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation mean1 518 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
Leaf compoundnesssimple
Leaf shapeelliptical obovate terete
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry9
Leaf C:N ratio22.81 g/g
Leaf c431 mg/g
Leaf dry-matter content (LDMC)330 mg/g
⚠ sources differ — TRY: 330 mg/g · LEDA: 256 mg/g
Leaf n20.57 mg/g
Leaf p1.29 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)15.78 mm²/mg
⚠ sources differ — TRY: 15.78 mm²/mg · LEDA: 13.16 mm²/mg · GIFT: 13.03 mm²/mg
Wood density631 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition92 compounds
Compounds documented for Berberis vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids29
Isoquinoline alkaloids $ Protoberberine alkaloids15
Isoquinoline alkaloids9
Aporphine alkaloids $ Isoquinoline alkaloids8
Flavonols6
Documented compounds92 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Berbamine | present | LOTUS | |
| (+)-Lyoniresinol | present | LOTUS | |
| (+)-Magnoflorine | present | LOTUS | |
| (-)-Galantamine | present | NPASS | |
| (14S)-16,17-dimethoxy-14-(trichloromethyl)-5,7-dioxa-13-azapentacyclo[11.8.0.02,10.04,8.015,20]henicosa-1(21),2,4(8),9,15(20),16,18-heptaene | present | LOTUS | |
| (14S)-16,17-dimethoxy-5,7-dioxa-13-azapentacyclo[11.8.0.02,10.04,8.015,20]henicosa-1(21),2,4(8),9,15(20),16,18-heptaen-14-ol | present | LOTUS | |
| (1S)-1,2,3,4-Tetrahydro-1-((4-(2-hydroxy-5-(((1R)-1,2,3,4-tetrahydro-7-hydroxy-6-methoxy-2-methyl-1-isoquinolinyl)methyl)phenoxy)phenyl)methyl)-6-methoxy-2-methyl-7-isoquinolinol | present | LOTUS | |
| (1S,14R)-20,21,25-trimethoxy-15,30-dimethyl-8,23-dioxa-15,30-diazaheptacyclo[22.6.2.29,12.13,7.114,18.027,31.022,33]hexatriaconta-3(36),4,6,9(35),10,12(34),18,20,22(33),24,26,31-dodecaen-6-ol | present | NPASS | |
| (1S,14S)-20,21,25-trimethoxy-15,30-dimethyl-8,23-dioxa-15,30-diazaheptacyclo[22.6.2.29,12.13,7.114,18.027,31.022,33]hexatriaconta-3(36),4,6,9(35),10,12(34),18,20,22(33),24,26,31-dodecaen-6-ol | present | NPASS | |
| (1S,15R)-10,21,22,26-tetramethoxy-16,31-dimethyl-8,24-dioxa-16,31-diazaheptacyclo[23.6.2.13,7.19,13.115,19.028,32.023,34]hexatriaconta-3(36),4,6,9,11,13(35),19,21,23(34),25,27,32-dodecaene | present | LOTUS |
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Berberis vulgaris has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes6
GenBank sequences10
eDNA detections14
Countries7
The DNA barcodea real sequence read deposited for this species
AGGGCACGTCTGCCTGGGCGTCACGCACAGCGTCGCGCTCAACACAAGCAATGTTTTCGTGTTGATGAGCGGAAGTTGGCCACCCGAGCT …
Berberis vulgaris voucher Hm1342-ITS3 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Berberis vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 603 920 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Berberis vulgaris1.6 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records28–562n range28median28mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2830×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iber-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1676
CCDB · fl-europaea — Mattick, 1950
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl — Verlaque, R., M. Seidenbinder & P. Donadille. 1987. Recherches cytotaxonomiques sur la spéciation en région Méditerranéenne I: espèces a nombre chromosomique stable. Biol.-Ecol. Medit. 10: 273–289.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · ipcn-api-dl — Pacheco. 2004. Números cromosómicos para la flora Española. 819--830. Lagascalia 24: 175–182.
CCDB · book-northern-plants — Dennen 1931.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol1 — Giffen, M.H. 1936
CCDB · book-indian_vol1 — Singhal, V.K. et al. 1980a
CCDB · book-indian_vol1 — Langlet, O.F.J. 1928 ; Tischler, G. 1928; Dermen, H. 1931b; Giffen, M.H. 1936; Delay, C. 1947; Contandriopoulos, J. 1962
CCDB · book-fedorov — Quezel 1957
CCDB · book-fedorov — Giffen 1936
CCDB · book-fedorov — Langlet 1928
CCDB · book-fedorov — Tischler 1928
CCDB · book-fedorov — Dermen 1931b
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Contandriopoulos 1962
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Magulaev, A. Y. (1984). Cytotaxonomix study in some flowering plants of the North Caucasus. Bot. Žurn. 69: 511-517.
CCDB · CromoCat 2015 — Markova, M. & Goranova, V. (1987). Hromozonini cisla na njakoi predstaviteli ot Magnoliopsida. In: Trudove IV nacionalna konferencija po botanika 1: 32-37.
CCDB · CromoCat 2015 — Verlaque, R., M. Seidenbinder & P. Donadille. (1987a). Recherches cytotaxonomiques sur la spéciation en région méditerranéenne. I: Espèces à nombre chromosomique stable. Rev. Biol.-Écol. Méd. 10(4): 274-289.
2n 561×CCDB · kew
CCDB · kew — Bottini MCJ, Greizerstein EJ, Premoli AC, Poggio L. 1998. Genome size and meiotic behavior of Berberis L. species from Patagonia, Argentina. Cytogenetics and Cell Genetics 81: 125 and pers. comm.
n 1413×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — IOPB. Chromosome data 5 (ed. C.A. Stace). Diosdado, J. C., F. Ojeda & J. Pastor.Int. Organ. Pl. Biosyst. Newslett.20: 6(1993).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 435-455. Silvestre, S.Lagascalia14(2): 273-281(1986).
CCDB · ipcn-api-dl — Jee, V., U. Dhar & P. Kachroo. 1987. Addition to the cytological conspectus of alpine--subalpine flora of Kashmir Himalaya. CIS Chromosome Inform. Serv. 43: 7–9.
CCDB · ipcn-api-dl — Sandhu, P. S. & S. K. Mann. 1988. SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219–228.
CCDB · ipcn-api-dl — Jee, V., U. Dhar & P. Kachroo. 1989. Cytogeography of some endemic taxa of Kashmir Himalaya. Proc. Indian Natl. Sci. Acad., B 55: 177–184.
CCDB · ipcn-api-dl — Singhal, V. K., B. S. Gill & S. S. Bir. 1980. In Chromosome number reports LXVII. Taxon 29: 355–357.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Silvestre, S. 1986. Números cromosómicos para la flora Española, 435--455. Lagascalia 14: 273–281.
CCDB · ipcn-api-dl — Diosdado, J. C., F. Ojeda & J. Pastor. 1993. IOPB chromosome data 5. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 20: 6–7.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Mesí?ek, J. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesícek & V. Javurková-Jarolímová. Academia, Praha NONE LISTED
CCDB · CromoCat 2015 — Mehra, P.N. & T.S. Sareen. (1969). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXII]. Taxon 18(3): 439-441.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type131 523 records
Wild obs. + sensor125 322
Museum / vouchered5 400
Cultivated / captive44
Fossil2
Other755
Origin
Native1 234
Introduced160
Range
Area of Occupancy AOO146 588 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 30 224≤1 km 15 043≤10 km 54 967>10 km 1 333
101 567 georeferenced · 23 755 without coordinates
Open the mapobservation + sensor125 322
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 338≤1 km 937≤10 km 2 024>10 km 258
3 557 georeferenced · 1 843 without coordinates
Open the institutions mapphysical evidence5 400
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy19% within 1 km
≤100 m 4≤1 km 1≤10 km 13>10 km 9
27 georeferenced · 17 without coordinates
Open the mapnot free-living44
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions128 of 226 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 225 |
| LDlocation not on record | 274 |
| Olocation not on record | 272 |
| Salzburg, AT | 237 |
| Moscow State Universitylocation not on record | 177 |
| MeiseBGlocation not on record | 132 |
| SLU Artdatabankenlocation not on record | 132 |
| Helsinki, FI | 95 |
| Tartu, EE | 88 |
| Karlsruhe, DE | 87 |
| KMNlocation not on record | 87 |
| Trondheim, NO | 86 |
| Oskarshamn, SE | 84 |
| Mlocation not on record | 69 |
| University of New Hampshirelocation not on record | 67 |
| Görlitz, DE | 62 |
| Adam Mickiewicz University in Poznańlocation not on record | 61 |
| Bergen, NO | 61 |
| Kuopio, FI | 60 |
| Chongqing Museumlocation not on record | 57 |
| BIO-UNIPIlocation not on record | 55 |
| Burlington, US | 40 |
| BFLlocation not on record | 39 |
| Uppsala, SE | 38 |
| Philadelphia, US | 38 |
| New Haven, US | 36 |
| Vitoria, ES | 36 |
| MAlocation not on record | 33 |
| Zürich, CH | 32 |
| Turku, FI | 31 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 26 |
| Xining, CN | 23 |
| Tallinn, EE | 23 |
| Jyväskylä, FI | 23 |
| Provincia di Livornolocation not on record | 23 |
| Museo Entomologico de Leonlocation not on record | 23 |
| Bern, CH | 22 |
| Philadelphia, US | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| Ann Arbor, US | 21 |
| Oulu, FI | 20 |
| Zürich, CH | 20 |
| Wlocation not on record | 20 |
| Uniwersytet Warszawskilocation not on record | 20 |
| Madison, US | 18 |
| DBF-NHMDlocation not on record | 18 |
| BClocation not on record | 17 |
| Tampere, FI | 17 |
| South Kensington, GB | 17 |
| Uniwersytet Jagiellońskilocation not on record | 17 |
| Québec, CA | 17 |
| BRNUlocation not on record | 17 |
| Toronto, CA | 15 |
| University of Stellenboschlocation not on record | 14 |
| SWlocation not on record | 13 |
| Auckland, NZ | 13 |
| Saint Louis, US | 13 |
| GJOlocation not on record | 13 |
| Denver, US | 13 |
| Vancouver, CA | 12 |
| College Park, US | 12 |
| Staten Island, US | 12 |
| Acadia Universitylocation not on record | 12 |
| Moscow, US | 10 |
| Bloomington, US | 10 |
| Bronx, US | 10 |
| TROMlocation not on record | 9 |
| Porvoo, FI | 9 |
| Berlin, DE | 9 |
| San Sebastián, ES | 9 |
| Missoula, US | 9 |
| Wellington, NZ | 9 |
| Christchurch, NZ | 9 |
| Paris, FR | 9 |
| Philadelphia, US | 8 |
| St. Paul, US | 8 |
| Montréal, CA | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| Hudson, US | 7 |
| Edinburgh, GB | 7 |
| Kingston, US | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Barcelona, ES | 7 |
| Hobart, AU | 7 |
| Pullman, US | 7 |
| Guangzhou, CN | 7 |
| Tula State Universitylocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Porrentruy, CH | 6 |
| Frauenfeld, CH | 6 |
| Frankfurt am Main | 6 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| Beijing, CN | 5 |
| Chengdu, CN | 5 |
| Keene State Universitylocation not on record | 5 |
| València, ES | 5 |
| MHNAIXlocation not on record | 5 |
| Stockholm, SE | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| Allentown, US | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| LfUlocation not on record | 4 |
| PRClocation not on record | 4 |
| UGentlocation not on record | 4 |
| Fredericksburg, US | 4 |
| Madrid, ES | 4 |
| Glarus, CH | 4 |
| Canberra, AU | 4 |
| Mount Annan, AU | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Bourges, FR | 4 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Salamanca, ES | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Cheney, US | 3 |
| Boise, US | 3 |
| Sion, CH | 3 |
| Mohonk Preservelocation not on record | 3 |
| US | 3 |
| SZUlocation not on record | 3 |
| Wuzhou, CN | 3 |
| Albuquerque, US | 3 |
| Durham, US | 3 |
| Kew, GB | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Tilburg, NL | 3 |
| Tampa, US | 3 |
| Uniwersytet w Białymstokulocation not on record | 3 |
| WINlocation not on record | 3 |
| Université Lavallocation not on record | 3 |
| Davenport, US | 3 |
| Fulda, DE | 3 |
| Monastir, TN | 2 |
| CICYTEXlocation not on record | 2 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 2 |
| IDElocation not on record | 2 |
| Pocatello, US | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Göteborg, SE | 2 |
| New Brunswick, US | 2 |
| Hamilton, US | 2 |
| Namur, BE | 2 |
| Dresden, DE | 2 |
| Cambridge, US | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| Mexico City, MX | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| Oswego, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| GZUlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Chinese Academy of Forestrylocation not on record | 2 |
| Cincinnati, US | 2 |
| Logan, US | 2 |
| München, DE | 2 |
| AZE015location not on record | 2 |
| Smithfield, AU | 1 |
| Chengdu, CN | 1 |
| McWane Science Centerlocation not on record | 1 |
| Dover, US | 1 |
| Riverside, US | 1 |
| Corvallis, US | 1 |
| Saint John, CA | 1 |
| Dekalb, US | 1 |
| ASUlocation not on record | 1 |
| Spearfish, US | 1 |
| Badajoz, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Salvador, BR | 1 |
| Pretoria, ZA | 1 |
| Davis, US | 1 |
| WTUlocation not on record | 1 |
| Macomb, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Chengdu, CN | 1 |
| Siouxland Heritage Museumlocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| TUR-Alocation not on record | 1 |
| CJBGlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Pamplona, ES | 1 |
| BDBClocation not on record | 1 |
| Brookings, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Nanjing, CN | 1 |
| Rotorua, NZ | 1 |
| BSBIlocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Fayetteville, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Bangkok, TH | 1 |
| Nijmegen, NL | 1 |
| Boumlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Taipei, TW | 1 |
| Chicago, US | 1 |
| Winterthur, CH | 1 |
| Victoria, CA | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Mississippi State, US | 1 |
| Yangling, CN | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| San Jose, US | 1 |
| Gijón, ES | 1 |
| Alicante, ES | 1 |
| Chadron, US | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| ROM020location not on record | 1 |
| CBDClocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| nbflocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Xiamen, CN | 1 |
| Millersville, US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
226 institutions · 4 889 of 5 400 vouchered records shown · 475 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Berberis vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map5 countries0
on road verge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.7 °C 10.7–22.0
Seasonal swing summer↔winter22.6 °C
Max temp (day)21.0 °C 12.9–26.8
Min temp (night)10.4 °C 7.70–18.0
Precipitation75.0 mm/mo 52.7–133
Air humidity58.2 % 52.2–63.1
Moisture balance-52.3 mm/mo -68.9–126
Vapour deficit809 Pa 469–1,321
Wind speed4.10 m/s 2.80–5.40
Cloud cover38.4 % 24.0–45.8
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.