Berberis chilensis

Gillies · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Berberidaceae/Berberis

At a glance

Occurrence records427

Data sources9

Biological traits11

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Berberis chilensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF427 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Berberis chilensis là một loài thực vật có hoa trong họ Hoàng mộc. Loài này được Gillet mô tả khoa học đầu tiên năm 1833.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 600 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition9 compounds

Compounds documented for Berberis chilensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones8

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(10S)-5,7,8,15-tetrahydroxy-19,19-dimethyl-22-(3-methylbut-2-enyl)-10-prop-1-en-2-yl-2,20-dioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(14),3(12),4(9),5,7,15,17,21-octaen-13-one	present	NPASS
(13R)-6,8,17,19-tetrahydroxy-14,14-dimethyl-5,7-bis(3-methylbut-2-enyl)-3,15-dioxapentacyclo[11.6.1.02,11.04,9.016,20]icosa-1(20),2(11),4,6,8,16,18-heptaen-10-one	present	NPASS
(17S)-12,21,23-trihydroxy-8,8,18,18-tetramethyl-11-(3-methylbut-2-enyl)-3,9,19-trioxahexacyclo[15.6.1.02,15.04,13.05,10.020,24]tetracosa-1(24),2(15),4,6,10,12,20,22-octaen-14-one	present	NPASS
(17S)-12,21,23-trihydroxy-8,8,18,18-tetramethyl-5-(3-methylbut-2-enyl)-3,7,19-trioxahexacyclo[15.6.1.02,15.04,13.06,11.020,24]tetracosa-1(24),2(15),4(13),5,9,11,20,22-octaen-14-one	present	NPASS
(6S)-2,3,8,10-tetrahydroxy-9,11-bis(3-methylbut-2-enyl)-6-(2-methylprop-1-enyl)-6H-chromeno[4,3-b]chromen-7-one	present	NPASS
(S)-Reticuline	present	LOTUS
Artorigidin A	present	NPASS
Heterophyllin	present	NPASS
Pannokin B	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Berberis chilensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH494590.1 ↗607 bpChile

ACGT

TTGAAACCTGCATAGCAGAAAGACCCGCGAACTTGTGAACAACTATATTGGGAGAGGGATACGGGCTTCTTGGACTCCTTCCCCCGATTT …

Berberis chilensis var. chilensis voucher 215 (NYBG) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type427 records

Wild obs. + sensor385

Museum / vouchered39

Cultivated / captive3

Range

Area of Occupancy AOO1 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 222≤1 km 45≤10 km 20>10 km 15

302 georeferenced · 83 without coordinates

Open the mapobservation + sensor385

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 3

5 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence39

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	13
Chicago, US	6
Valparaiso, CL	6
San Jose State University, Museum of Birds and Mammalslocation not on record	4
Edinburgh, GB	3
Saint Louis, US	2
Nunoa, Santiago, CL	1
UChlocation not on record	1
IPA/SPlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1

11 institutions · 39 of 39 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Berberis chilensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)