Berberis aristata

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Berberidaceae/Berberis

At a glance

Occurrence records310

Data sources13

Biological traits34

DNA specimens17

eDNA detections17

Sources13 archives

Databases and archives Berberis aristata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF310 records

Environmental DNA1 datasets · 0 countries17 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB · GoaT1.4 Gbp

01Narrative

Berberis sikkimensis is a plant species native to the high Himalayas at elevations of 2000–3000 m. It is known from Sikkim, Nepal, Bhutan, Tibet and Yunnan.Flora of China v 19 p 769, Berberis sikkimensis Berberis sikkimensis is a shrub up to 250 cm tall, with pale yellow spines up to 20 mm long on the younger twigs. Leaves are egg-shaped, up to 25 mm long, leathery, heavily whitened with a waxy layer below. Inflorescence is a panicle or raceme of up to 20 flowers. Berries are dark red, narrowly egg-shaped, up to 15 mm long.Schneider, Camillo Karl. 1905. Bulletin de l'Herbier Boissier, sér. 2 5: 453, Berberis chitria var. sikkimensisAhrendt, Leslie Walter Allen. 1942. Journal of Botany, British and Foreign 80: 85, Berberis sikkimensis

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology17

Fruit length15 mm

Fruit length max15 mm

Fruit length min15 mm

Fruit width4.5 mm

Fruit width max4.5 mm

Fruit width min4.5 mm

Inflorescence length max5 cm

Inflorescence length min3 cm

Leaf length21 mm

Leaf length max30 mm

Leaf length min10 mm

Leaf width max10 mm

Leaf width min5 mm

Plant height2 m

Plant height max3 m

Plant height min1.5 m

Seed mass11.95 mg

Life cycle & reproduction5

Dehiscenceindehiscent

Flowering endJun

Flowering startApr

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 500 m

Elevation mean2 500 m

Elevation min1 600 m

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Berberis aristata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Isoquinoline alkaloids $ Protoberberine alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(S)-Reticuline		present	LOTUS
Berberine		present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Berberis aristata has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes4

GenBank sequences10

eDNA detections17

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR765726.1 ↗305 bpIndia · 2022

ACGT

TTATGCGATTACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCACTAGGCTGAGGGCA …

Berberis aristata isolate IMR2021C6 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Berberis aristata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 383 870 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Berberis aristata1.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy2× diploid · measured

Chromosome records28–282n range28median28mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol1 · CCDB · book-fedorov

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-indian_vol1 — Giffen, M.H. 1936; Mehra, P.N. & Sareen, T.S. 1969, 1973c

CCDB · book-fedorov — Giffen 1936

n 145×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1

CCDB · iapt — IAPT/IOPB Chromosome Data 12

CCDB · ipcn-api-dl — Sandhu, P. S. & S. K. Mann. 1988. SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219–228.

CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.

CCDB · book-ipcn67-71 — MEHRA, P.N., & T.S. SAREEN. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.

CCDB · book-ipcn73-74 — MEHRA, P.N., & T.S. SAREEN. 1973. Cytology of some Himalayan trees. Silvae Genet. 22: 66-70.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type310 records

Wild obs. + sensor51

Museum / vouchered252

Cultivated / captive7

Origin

Introduced14

Range

Area of Occupancy AOO792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 26≤1 km 7≤10 km 2>10 km 2

37 georeferenced · 14 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 3≤1 km 12≤10 km 5>10 km 4

24 georeferenced · 228 without coordinates

Open the institutions mapphysical evidence252

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	45
Herbarium of the Department of Botany, University of Tokyolocation not on record	45
Edinburgh, GB	32
Natural History Museum, Tribhuvan Universitylocation not on record	11
Kathmandu, NP	8
Christchurch, NZ	7
Saint Louis, US	6
Museo Entomologico de Leonlocation not on record	3
CASlocation not on record	3
Pretoria, ZA	3
Brisbane, AU	2
Alicante, ES	1
Dublin, IE	1
San Sebastián, ES	1
Vancouver, CA	1
Hobart, AU	1
LDlocation not on record	1
Orto botanico dell'Università degli Studi di Catanialocation not on record	1
Uppsala, SE	1
Nanjing, CN	1
nlocation not on record	1
Rotorua, NZ	1
Vitoria, ES	1
Oskarshamn, SE	1

24 institutions · 178 of 252 vouchered records shown · 74 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Berberis aristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)