Benincasa fistulosa

(Stocks) H.Schaef. & S.S.Renner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Cucurbitaceae/Benincasa

At a glance

Occurrence records1

Data sources10

Biological traits10

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Benincasa fistulosa's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI≈833 Mbp

01Narrative

Praecitrullus fistulosus, commonly known as Tinda, also called Indian squash, round melon, Indian round gourd or apple gourd or Indian baby pumpkin, is a squash-like cucurbit grown for its immature fruit, a vegetable especially popular in South Asia. It is the only member of the genus Praecitrullus. The plant is as with all cucurbits, a prolific vine, and is grown as an annual. The plant also is prickly with small thorns similar to the zucchini. The fruit is approximately spherical, and 5–8 cm in diameter The seeds may also be roasted and eaten. Tinda is a famous nickname among Punjabi families in both India and Pakistan. This unique squash-like gourd is native to India, very popular in Indian and Pakistani cooking with curry and many gourmet dishes. Green colored, apple-sized fruits are flattish round in shape and 50–60 grams in weight. Plants are vigorous, productive and begin to bear fruits in 70 days after planting. Tinda is also called "ऐभी" and "हस्तिघोषालताफलम्" in Sanskrit . It's called "tindsi" in Rajasthan. In Marathi, it is called dhemase ढेमसे. in Hindi and Marathi also called "dilpasand" In Sindhi language, it is called meha (). Tinda can be confused with tendli or kundru due to similar-sounding names from different languages and regions. Tinda in Punjabi, Hindi and most North Indian languages is "Indian baby pumpkin".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction5

Life formclimbing annual

Life spanannual

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Habitat & environment4

Climateseasonally dry tropical

Climberobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Benincasa fistulosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ467161.1 ↗271 bpIndia

ACGT

GAATTCATTTCAAGTTCCTTGGCGCGACCTGCCCCGCCACACACAACACCCCATGCGGGCTCGTTGCGTAGGCAGGGGCACACGCTGGCC …

Benincasa fistulosa voucher AKP & Mayank DD 11270 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Benincasa fistulosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈833 108 074 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Benincasa fistulosa0.83 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 249×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +3

CCDB · ipcn-api-dl — Beevy, S. S. & P. Kuriachan. 1996. Chromosome numbers of south Indian Cucurbitaceae and a note on the cytological evolution in the family. J. Cytol. Genet. 31(1): 65–71.

CCDB · book-ipcn67-71 — ANGHEL, I. 1969. studies on the cytology and evolution of the Citrullus vulgaris. Comunicari de Bot. (Bucharest) 11: 49-55.

CCDB · book-indian_vol1 — Shimotsuma, M. 1961a ; Khoshoo, T.N. & Vij, S.P. 1963 ; Anghel, I. 1969

CCDB · book-fedorov — IlanraJio 1938

CCDB · book-fedorov — Shimotsuma 1961a

CCDB · book-fedorov — I. 1962)

CCDB · book-fedorov — Khoshoo, Vij 1963

CCDB · Cave1962 — Shimotsuma 1961

CCDB · Cave1963 — Khoshoo & Vij 1963

n 122×CCDB · ipcn-api-dl · CCDB · Cave1963

CCDB · ipcn-api-dl — Beevy, S. S. & P. Kuriachan. 1996. Chromosome numbers of south Indian Cucurbitaceae and a note on the cytological evolution in the family. J. Cytol. Genet. 31(1): 65–71.

CCDB · Cave1963 — Khoshoo & Vij 1963

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~5 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin5 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 records

Wild obs. + sensor1

Range

Area of Occupancy AOO4 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA3 detections

Where the DNA of Benincasa fistulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)