Bellis perennis
speciesAt a glance
Occurrence records937 839
Data sources16
Biological traits64
DNA specimens79
eDNA detections44
Sources16 archives
Databases and archives Bellis perennis's data was compiled from.
WikipediaWikimedia Foundation19 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility937 839 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics79 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources64 traits
Chemical compositionLOTUS · NPASS235 compounds
Occurrence & distributionGBIF937 839 records
Environmental DNA1 datasets · 11 countries44 detections
DNA & barcodingBOLD · NCBI79 specimens
Genome at a glanceCCDB · GIFT · GoaT1.7 Gbp
01Narrative
Bellis perennis, the daisy, is a European species of the family Asteraceae, often considered the archetypal species of the name daisy. To distinguish this species from other plants known as daisies, it is sometimes qualified as common daisy, lawn daisy or English daisy.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology23
Fruit length1.3 mm
⚠ sources differ — AusTraits: 1.3 mm · GIFT: 1 mm
Fruit width1 mm
Leaf length22.5 mm
Leaf length max80 mm
Leaf length min10 mm
Leaf mass11.63 mg
Leaf size791 mm²
⚠ sources differ — TRY: 791 mm² · LEDA: 359 mm² · GIFT: 359 mm²
Leaf width15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 14 mm
Leaf width max25 mm
Leaf width min5 mm
Plant height0.092 m
⚠ sources differ — GIFT: 0.092 m · LEDA: 0.055 m · TRY: 0.05 m
Plant height generative0.101 m
Plant height max0.2 m
Plant height min0.05 m
Seed length1.5 mm
⚠ sources differ — TRY: 1.5 mm · GIFT: 1.2 mm
Seed length max1.2 mm
Seed length min1.2 mm
Seed mass0.121 mg
⚠ sources differ — TRY: 0.121 mg · LEDA: 0.108 mg · GIFT: 0.133 mg
Seed mass max0.17 mg
Seed mass min0.09 mg
Seed volume0.11 mm³
Seed volume max0.11 mm³
Seed volume min0.11 mm³
Life cycle & reproduction14
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flowering endJun
Flowering startApr
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number744
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTforest, meadows, meadows: wet, roadsides
Leaf shapeobovate spathulate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio17.1 g/g
Leaf c416 mg/g
Leaf dry-matter content (LDMC)121 mg/g
⚠ sources differ — TRY: 121 mg/g · LEDA: 114 mg/g
Leaf n22.1 mg/g
Leaf p3.27 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)33.15 mm²/mg
⚠ sources differ — TRY: 33.15 mm²/mg · LEDA: 28.7 mm²/mg · GIFT: 27.08 mm²/mg
Wood density74.82 mg/cm³
Other traits2
Diaspore typegenerative dispersule
Seeds per fruit101-1000
03Chemical composition235 compounds
Compounds documented for Bellis perennis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids58
Acyclic monoterpenoids15
Flavonols14
Branched fatty acids $ Unsaturated fatty acids10
Hydrocarbons8
Documented compounds235 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-cis-Verbenol | present | LOTUS | |
| (+)-pulegone | present | LOTUS | |
| (+)-trans-Pinocarveol | present | LOTUS | |
| (-)-alpha-Himachalene | present | LOTUS | |
| (-)-Caryophyllene | present | LOTUS | |
| (-)-gamma-Cadinene | present | LOTUS | |
| (-)-Lavandulol | present | LOTUS | |
| (-)-trans-Carveol | present | LOTUS | |
| (1aS,4aS,7aS,7bR)-1,1,7-trimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulene | present | LOTUS |
05DNA & barcoding79 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Bellis perennis has left across the world's sequence archives.
At a glance
DNA specimens79
Marker genes8
GenBank sequences10
eDNA detections44
Countries11
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC …
Bellis perennis voucher PLT.0279 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★trnL-F★ITS5★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Bellis perennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 740 840 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Bellis perennis1.74 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–182n range18median18mode82records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1882×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +19
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — TORNADORE N., POPOVA M., GARBARI F. - 1974. Numeri cromosomici per la flora italiana:172-181.. Inform. Bot. Ital. , 6(1): 43-54.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Feráková V., Kochjarová J., Králik E., Schwarzová T. & Záborský J., 1997: Cievnaté rastliny, pp. 86-156. - In: Feráková V. & Kocianová E. (eds), Flóra, geológia a paleontológia Devínskej Kobyly. Litera, Bratislava.
CCDB · slov-fl — Murín A., 1993: Karyologické štúdium okrasných rastlín flóry Slovenska. - Biológia (Bratislava) 48/4: 441-445.
CCDB · brit-fl — Tischler, G. Tabulae. Biol. 12: 57-115 (1937)
CCDB · brit-fl — Jones, K. (1969)
CCDB · brit-fl — Stern, W.T., Brighton, C. J. Roy. Hort. Soc. 94: 403-408 (1969)
CCDB · brit-fl — Marchant, H. (1968)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4033
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Murthy, H. N. 1988. Karyomorphological studies in Bellis perennis L. CIS Chromosome Inform. Serv. 45: 3–4.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Baltisberger, M. 1991. Cytological investigations of some Greek plants. Fl. Medit. 1: 157–173.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Kriemadi, E., P. Bareka & G. Kamari. 2002. Mediterranean chromosome number reports 12 (1278--1283). Fl. Medit. 12: 444–450.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · book-ipcn67-71 — KUZMANOV, B.A., & S.I. KOZUHAROV. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-northern-plants — Negodi 1935, Winge 1917.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-indian_vol1 — Ishikawa, M.1916; Winge, O. 1917b ; Heitz, E. 1926; Bolton (Tischler, G. 1935-1936) ; Tischler, G. 1934, 1937 ; Negodi, G. 1935, 1937d, e; Rohweder, H. 1937 ; Delay, C. 1947; Felfoldy, L.J.M. 1947a ; Heiser, C.B. & Whitaker, T.W. 1948; Huziwara, Y. 1954; Love, A. & Love, D. 1956b ; Contandriopou- los, J. 1957c,_1962 ; Garajova, S. 1959; Piotrowicz (Skalinska, M. et al. 1959) ; Gadella, T.W.J. & Kliphuis, E. 1963 ; Mehra, P.N. et al. 1965 ; Sharma, A. & Sarkar, A.K. 1967-1968 ; Taylor, R.L. & Mulligan, G.A. 1968 ; Kuzmanov, B.A. & Kozuharov, S.I. 1970 ; Fernandes, A. & Queiros, M. 1971 ; Mehra, P.N. & Remanandan, P. 1974 ; Witherspoon, J. T. et al. .1974 ; Javfirkova, V. 1980
CCDB · eflora
CCDB · book-fedorov — Ishikawa 1916
CCDB · book-fedorov — Winge 1917b
CCDB · book-fedorov — Heitz 1926
CCDB · book-fedorov — Bolton (T. 19351936)
CCDB · book-fedorov — Tischler 1934, 1937
+42 more references
n 913×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn73-74 — WITHERSPOON, J.T., C.G. SCHAACK, & T.J. WATSON JR. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
CCDB · CromoCat 2015 — Carr, G. D., King, R. M., Powell, A. M. & Robinson, H. (1999). Chromosome numbers in Compositae. XVIII Amer. J. Bot. 86: 1003-1013.
CCDB · CromoCat 2015 — Javurková, V. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 713-714.
CCDB · CromoCat 2015 — Mehra, P. N., B. S. Gill, J. K. Mehta & S. S. Sidhu. (1965a). Cytological investigations on the Indian Compositae. I. North Indian taxa. Caryologia 18: 35-68.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Witherspoon, J. T., C. G. Schaack & T. J. Watson. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 801-802.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness95.7% BUSCO
07Deep time~2.96 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.96 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type937 839 records
Wild obs. + sensor924 629
Museum / vouchered11 277
Cultivated / captive544
Other1 389
Origin
Native53 169
Introduced521
Range
Area of Occupancy AOO697 748 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 193 562≤1 km 181 963≤10 km 407 602>10 km 5 619
788 746 georeferenced · 135 883 without coordinates
Open the mapobservation + sensor924 629
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 622≤1 km 1 826≤10 km 3 846>10 km 146
6 440 georeferenced · 4 837 without coordinates
Open the institutions mapphysical evidence11 277
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy3% within 1 km
≤1 km 1≤10 km 14>10 km 17
32 georeferenced · 512 without coordinates
Open the mapnot free-living544
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions169 of 302 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 225 |
| BIO-UNIPIlocation not on record | 634 |
| BFLlocation not on record | 553 |
| Berlin, DE | 470 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 431 |
| LDlocation not on record | 389 |
| Salzburg, AT | 281 |
| Görlitz, DE | 215 |
| Olocation not on record | 143 |
| Oskarshamn, SE | 119 |
| MeiseBGlocation not on record | 117 |
| UniKSlocation not on record | 115 |
| Moscow State Universitylocation not on record | 111 |
| KMNlocation not on record | 104 |
| SLU Artdatabankenlocation not on record | 101 |
| València, ES | 99 |
| Karlsruhe, DE | 99 |
| Trondheim, NO | 91 |
| Bergen, NO | 86 |
| Entomological Society of Latvialocation not on record | 74 |
| South Kensington, GB | 72 |
| MAlocation not on record | 71 |
| Uniwersytet Warszawskilocation not on record | 70 |
| Adam Mickiewicz University in Poznańlocation not on record | 68 |
| Kuopio, FI | 66 |
| BDBClocation not on record | 64 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 61 |
| Uniwersytet Opolskilocation not on record | 60 |
| Tartu, EE | 57 |
| Vitoria, ES | 54 |
| BClocation not on record | 51 |
| Museo Entomologico de Leonlocation not on record | 50 |
| Barcelona, ES | 50 |
| CICYTEXlocation not on record | 49 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 44 |
| IFR-DNFlocation not on record | 44 |
| San Sebastián, ES | 43 |
| Auckland, NZ | 43 |
| Chongqing Museumlocation not on record | 42 |
| WTUlocation not on record | 40 |
| Christchurch, NZ | 40 |
| Pamplona, ES | 40 |
| Provincia di Livornolocation not on record | 37 |
| Oulu, FI | 36 |
| Hobart, AU | 36 |
| Corvallis, US | 35 |
| UGentlocation not on record | 34 |
| Vancouver, CA | 34 |
| Pullman, US | 33 |
| Badajoz, ES | 32 |
| ISAlocation not on record | 30 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 27 |
| Madrid, ES | 25 |
| Jaén, ES | 25 |
| Jyväskylä, FI | 25 |
| Turku, FI | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| GZUlocation not on record | 24 |
| Wlocation not on record | 24 |
| CJBGlocation not on record | 23 |
| Bern, CH | 22 |
| Arcata, US | 22 |
| Wellington, NZ | 22 |
| TROMlocation not on record | 21 |
| Uppsala, SE | 20 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 19 |
| Philadelphia, US | 19 |
| Ann Arbor, US | 19 |
| Salamanca, ES | 19 |
| Tallinn, EE | 19 |
| Santa Cruz, US | 18 |
| Adelaide, AU | 18 |
| Palacký University in Olomouclocation not on record | 18 |
| Mlocation not on record | 18 |
| College of the Atlantic, Museumlocation not on record | 18 |
| Mount Annan, AU | 17 |
| Philadelphia, US | 17 |
| Natural History Museum Rotterdamlocation not on record | 17 |
| BRNUlocation not on record | 16 |
| Riverside, US | 16 |
| Zürich, CH | 15 |
| Canberra, AU | 15 |
| Parkville, AU | 15 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 14 |
| Helsinki, FI | 12 |
| Saint Louis, US | 12 |
| GJOlocation not on record | 12 |
| Frankfurt am Main | 12 |
| Museo Achille Folettolocation not on record | 12 |
| Bronx, US | 12 |
| Córdoba, ES | 11 |
| San Luis Obispo, US | 11 |
| Montréal, CA | 11 |
| Phyletisches Museum Jenalocation not on record | 11 |
| Granada, ES | 11 |
| Porrentruy, CH | 10 |
| Portland, US | 10 |
| GMBAlocation not on record | 10 |
| Beijing, CN | 10 |
| Rotorua, NZ | 10 |
| Davis, US | 9 |
| Turlock, US | 9 |
| College Park, US | 9 |
| Toronto, CA | 8 |
| Tacoma, US | 8 |
| Québec, CA | 8 |
| Winterthur, CH | 8 |
| Zürich, CH | 8 |
| PrivatHerblocation not on record | 8 |
| Chapel Hill, US | 8 |
| Mexico City, MX | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Porvoo, FI | 8 |
| Madison, US | 8 |
| Pamplona, ES | 8 |
| Alicante, ES | 7 |
| Bourges, FR | 7 |
| Tilburg, NL | 7 |
| Podgorica, ME | 7 |
| Dresden, DE | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 7 |
| Palmerston North, NZ | 7 |
| Paris, FR | 7 |
| DASSHlocation not on record | 7 |
| US | 7 |
| Santa Barbara, US | 6 |
| San Francisco, US | 6 |
| National Biodiversity Institute, Costa Ricalocation not on record | 6 |
| Stockholm, SE | 6 |
| Rishon Le Zion, IL | 6 |
| Burlington, US | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| San Diego, US | 6 |
| Moscow, US | 6 |
| Otaru, JP | 5 |
| University of Stellenboschlocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Salvador, BR | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Wuzhou, CN | 5 |
| Long Beach, US | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Boise, US | 5 |
| Claremont, US | 5 |
| Kew, GB | 5 |
| Brisbane, AU | 4 |
| Missoula, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| Angwin, US | 4 |
| Flagstaff, US | 4 |
| CASlocation not on record | 4 |
| Garðabær, IS | 4 |
| Victoria, CA | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| PRClocation not on record | 4 |
| Allentown, US | 4 |
| TUR-Alocation not on record | 4 |
| QAUlocation not on record | 4 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 4 |
| Armidale, AU | 4 |
| Sevilla, ES | 4 |
| Herb. BBGlocation not on record | 4 |
| Banyoles, ES | 4 |
| Taipei, TW | 4 |
| Provo, US | 4 |
| SZUlocation not on record | 4 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| Columbia, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Emporia, US | 3 |
| Denver, US | 3 |
| BSBIlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Coimbra, PT | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Université Lavallocation not on record | 3 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 3 |
| Ashland, US | 3 |
| Valparaíso, CL | 3 |
| CIBIOlocation not on record | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Rovaniemi, FI | 3 |
| DBF-NHMDlocation not on record | 3 |
| Glarus, CH | 3 |
| EL PASO, US | 3 |
| Irvine, US | 3 |
| Frauenfeld, CH | 3 |
| OLAlocation not on record | 3 |
| Bloomington, US | 3 |
| *unvoucheredlocation not on record | 3 |
| Bratislava, SK | 3 |
| Davenport, US | 3 |
| nbflocation not on record | 2 |
| National Botanic Garden of Waleslocation not on record | 2 |
| Sion, CH | 2 |
| QVMAGlocation not on record | 2 |
| New Brunswick, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Cheney, US | 2 |
| Pocatello, US | 2 |
| Valparaiso, CL | 2 |
| Acadia Universitylocation not on record | 2 |
| US | 2 |
| UEMAlocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Wuhan, CN | 2 |
| Tula State Universitylocation not on record | 2 |
| St. Paul, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Xiamen, CN | 2 |
| Laboratory of Palaeontologylocation not on record | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Fort Bragg, US | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Blacksburg, US | 2 |
| ASUlocation not on record | 2 |
| Durango, MX | 2 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 2 |
| Yangling, CN | 2 |
| Oswego, US | 2 |
| Kunming, CN | 2 |
| AASlocation not on record | 2 |
| Northridge, US | 2 |
| Longwood Universitylocation not on record | 2 |
| Durham, US | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Nijmegen, NL | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Portland, US | 1 |
| Miami, US | 1 |
| Knoxville, US | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Durham, US | 1 |
| Dover, US | 1 |
| National Museum Waleslocation not on record | 1 |
| Clemson, US | 1 |
| H-Hohlalocation not on record | 1 |
| AUT001location not on record | 1 |
| Mexico City, MX | 1 |
| US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Henderson, US | 1 |
| Williamsburg, US | 1 |
| Caldwell, US | 1 |
| Pittsburg, US | 1 |
| Los Angeles, US | 1 |
| STNFlocation not on record | 1 |
| Kagoshima, JP | 1 |
| Chiba, JP | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Kingston, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| Norfolk, US | 1 |
| RABATlocation not on record | 1 |
| Boumlocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Wuhan, CN | 1 |
| Staten Island, US | 1 |
| Chengdu, CN | 1 |
| Firenze, IT | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Bangkok, TH | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Xining, CN | 1 |
| La Paz, BO | 1 |
| Guatemala City, GT | 1 |
| Tsukuba, JP | 1 |
| Mexico City, MX | 1 |
| Bend, US | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Brussel, BE | 1 |
| La Trobe Universitylocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Corrientes, AR | 1 |
| Uberlândia, BR | 1 |
| NMBU:MINAlocation not on record | 1 |
| 1 | |
| University of Hamburglocation not on record | 1 |
| GB | 1 |
| ULBF-AGRlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
302 institutions · 10 392 of 11 277 vouchered records shown · 565 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA44 detections
Where the DNA of Bellis perennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found44
Studies independent surveys1
Countries11
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 44 detections have coordinates
Open the map11 countries0
oak,oison oak, grasses,mustard, cheese weed,…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.5 °C 7.10–18.3
Seasonal swing summer↔winter15.3 °C
Max temp (day)16.8 °C 9.00–23.1
Min temp (night)9.50 °C 4.00–13.9
Precipitation72.7 mm/mo 55.1–94.3
Air humidity61.0 % 57.7–63.8
Moisture balance-28.0 mm/mo -69.0–11.2
Vapour deficit602 Pa 384–857
Wind speed3.00 m/s 2.40–4.90
Cloud cover43.3 % 37.5–57.2
CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.