Begonia fuchsioides

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Begoniaceae/Begonia

At a glance

Occurrence records23

Data sources12

Biological traits17

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Begonia fuchsioides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources17 traits

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GIFT · GoaT≈374 Mbp

01Narrative

Begonia fuchsioides, the fuchsia begonia, is a species of flowering plant in the family Begoniaceae. It is native to Ecuador, Colombia, and western Venezuela, and has been introduced to Hawaii and Réunion. A small bush reaching , it is hardy to USDA zone 10a.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology7

Fruit width max10 mm

Leaf length max50 mm

Leaf length min12 mm

Leaf width max15 mm

Leaf width min8 mm

Plant height max1.2 m

Plant height min0.3 m

Life cycle & reproduction3

Dehiscencedehiscent

Life spanperennial

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Begonia fuchsioides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF485163.1 ↗720 bp

ACGT

CATTGCCGATTCCTGCAAAATGCAGAACAACCAGCGAACTAGTTTGTCGAATTCCCGCATGCGCGGGACGGTGCGGGGCGTGTCGGGGTG …

Begonia fuchsioides voucher L.L. Forrest 153 (E) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GIFT · GoaT · TreeOfSex

The complete instruction manual Begonia fuchsioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈373 914 052 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Begonia fuchsioides0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidydiploid inferred

Chromosome records24–842n range60median60mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 606×GoaT · Tree of Sex Database · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +3

GoaT · Tree of Sex Database — ↗

CCDB · book-ipcn67-71 — LEGRO, R.A.H., & J. DOORENBOS. 1969. Chromosome numbers in Begonia. Neth. J. Agric. Sci. 17: 189-202.

CCDB · book-indian_vol1 — Matsuura, H. & Okuno, S. 1936; Legro, R.A.H. & Doorenbos, J, 1969

CCDB · book-atlas-flowering-plants — M. & O. 1936

TreeOfSex · plant — Doorenbos1998 ↗

GIFT · GIFT (floras)

2n 242×CCDB · book-indian_vol1 · GIFT · GIFT (floras)

CCDB · book-indian_vol1 — Sharma, A. & Sarkar, A.K. 1967-1968; Sarkar, A.K. 1974

GIFT · GIFT (floras)

2n 401×GIFT · GIFT (floras)

GIFT · GIFT (floras)

2n 501×GIFT · GIFT (floras)

GIFT · GIFT (floras)

2n 841×GIFT · GIFT (floras)

GIFT · GIFT (floras)

n 124×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · TreeOfSex · plant

CCDB · ipcn-api-dl — Sarkar, A. K. 1989. Taxonomy of Begonia L. (Begoniaceae) as judged through cytology. Feddes Repert. 100: 241–250.

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.8% BUSCO

08Occurrence & distribution

Record type23 records

Wild obs. + sensor4

Museum / vouchered18

Cultivated / captive1

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 6≤10 km 5>10 km 1

12 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence18

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad de Caldas (UCaldas)location not on record	11
Auckland, NZ	2
Adam Mickiewicz University in Poznańlocation not on record	2
Tampa, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Karlsruhe, DE	1

6 institutions · 18 of 18 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Begonia fuchsioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)