Begonia formosana

(Hayata) Masam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Begoniaceae/Begonia

At a glance

Occurrence records1 844

Data sources11

Biological traits9

DNA specimens20

eDNA detections20

Sources11 archives

Databases and archives Begonia formosana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 844 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF1 844 records

Environmental DNA1 datasets · 0 countries20 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 60

01Narrative

Begonia formosana est une espèce de plantes de la famille des Begoniaceae. Ce bégonia est originaire du Japon et de Taïwan. L'espèce fait partie de la section Platycentrum ; elle a été décrite en 1961 par le botaniste japonais Genkei Masamune (1899-1993) à la suite de son homologue Bunzō Hayata (1874-1934). L'épithète spécifique, formosana, signifie « de Formose ».

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Begonia formosana has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes2

GenBank sequences10

eDNA detections20

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAJ491242.1 ↗705 bpTaiwan

ACGT

AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATACTAATTCAAACAACCGGTGAACATGTTAATAAAATTGGGTTGTG …

Begonia formosana 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial), isolate for-S5

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Begonia formosana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records60–602n range60median60mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 602×GoaT · Tree of Sex Database · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

TreeOfSex · plant — Goldblatt1979 ↗

n 303×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Peng, C. i. & T. Y. Chiang. 1998. Hybridity and parentage of Begonia taipeiensis Peng (Begoniaceae) from Taiwan. Amer. J. Bot. 85(6(Abstracts)): 174.

CCDB · ipcn-api-dl — Peng, C. i. & C. y. Sue. 2000. Begonia @x taipeiensis (Begoniaceae), a new natural hybrid in Taiwan. Bot. Bull. Acad. Sin. 41: 151–158.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 844 records

Wild obs. + sensor1 481

Museum / vouchered350

Cultivated / captive1

Other12

Origin

Native17

Range

Area of Occupancy AOO1 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 685≤1 km 199≤10 km 80>10 km 39

1 003 georeferenced · 478 without coordinates

Open the mapobservation + sensor1 481

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 38

38 georeferenced · 312 without coordinates

Open the institutions mapphysical evidence350

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	98
National Museum of Natural Sciencelocation not on record	73
Taipei, TW	63
Tsukuba, JP	38
Taipei, TW	37
TAIElocation not on record	17
Nishihara, JP	13
Beijing, CN	6
Sendai, JP	2
MeiseBGlocation not on record	1
Sanda, JP	1
Edinburgh, GB	1

12 institutions · 350 of 350 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Begonia formosana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Begonia formosana

At a glance

Sources11 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 844 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 844 records