Begonia ferruginea

L.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Begoniaceae/Begonia

At a glance

Occurrence records223

Data sources6

Biological traits9

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Begonia ferruginea's data was compiled from.

GBIFGlobal Biodiversity Information Facility223 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF223 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formshrub

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climber detailedself-supporting

Elevation max4 000 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formherb

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Begonia ferruginea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH559540.1 ↗705 bpColombia

ACGT

CATTGTCGATTCCTGCGAAATGCAGAACAACCAGCGAACAAGTTGTCGAATTCCCGCACTGCGCGGGACGGTGCGGGGCGTGTCGGAGCT …

Begonia ferruginea internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type223 records

Wild obs. + sensor113

Museum / vouchered110

Origin

Native1

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 52≤1 km 9≤10 km 9>10 km 1

71 georeferenced · 42 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 1≤1 km 21≤10 km 18>10 km 2

42 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	32
Universidad Nacional de Colombia (UNAL)location not on record	29
Pontificia Universidad Javeriana (PUJ)location not on record	9
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	8
IAvHlocation not on record	5
Universidad de Antioquia (UdeA)location not on record	5
Saint Louis, US	5
Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record	4
University of Stellenboschlocation not on record	4
Universidad de La Salle (La Salle)location not on record	2
Bronx, US	1
Kew, GB	1
Chicago, US	1
Universidad de los Andes (UniAndes)location not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

17 institutions · 110 of 110 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Begonia ferruginea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)