Beauveria brongniartii

(Sacc.) Petch · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Cordycipitaceae/Beauveria

At a glance

Occurrence records130

Data sources8

Biological traits0

DNA specimens56

eDNA detections53

Sources8 archives

Databases and archives Beauveria brongniartii's data was compiled from.

GBIFGlobal Biodiversity Information Facility130 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF130 records

Environmental DNA2 datasets · 5 countries53 detections

DNA & barcodingBOLD · NCBI56 specimens

Genome at a glanceNCBI≈33 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition6 compounds

Compounds documented for Beauveria brongniartii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cyclic peptides $ Depsipeptides $ Lipopeptides5

Fusidane triterpenoids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,6S,9S,13R)-9-benzyl-3-[(2R)-butan-2-yl]-6-methyl-13-[(2S)-octan-2-yl]-1-oxa-4,7,10-triazacyclotridecane-2,5,8,11-tetrone	present	LOTUS
(3R,6S,9S,13R)-9-benzyl-6-methyl-3-(2-methylpropyl)-13-[(2S)-octan-2-yl]-1-oxa-4,7,10-triazacyclotridecane-2,5,8,11-tetrone	present	LOTUS
2-(16-acetoxy-3,11-dihydroxy-4,8,10,14-tetramethyl-2,3,4,5,6,7,9,11,12,13,15,16-dodecahydro-1H-cyclopenta[a]phenanthren-17-ylidene)-6-methyl-hept-5-enoic acid	present	LOTUS
Beauverolide H	present	LOTUS
Beauverolide L	present	LOTUS
cyclo[D-Ala-D-Ile-ObAla(3R-octyl)-D-Phe]	present	LOTUS

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Beauveria brongniartii has left across the world's sequence archives.

At a glance

DNA specimens56

Marker genes4

GenBank sequences10

eDNA detections53

Countries10

The DNA barcodea real sequence read deposited for this species

ITSMH854761.1 ↗523 bp

ACGT

CGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTATGTGAACCTACCTATTGTTGCT …

Beauveria brongniartii strain CBS 109.24 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS2

animal barcodefungal barcode

06Genome at a glanceNCBI

The complete instruction manual Beauveria brongniartii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 487 931 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Beauveria brongniartii0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type130 records

Wild obs. + sensor28

Museum / vouchered101

Cultivated / captive1

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 7≤1 km 3≤10 km 1>10 km 5

16 georeferenced · 12 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence101

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	11
Odawara, JP	2
TENN-Flocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Chicago, US	1
Université de Montréal Biodiversity Centrelocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
PRClocation not on record	1
DPIlocation not on record	1
Karlsruhe, DE	1

11 institutions · 22 of 101 vouchered records shown · 67 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA53 detections

Where the DNA of Beauveria brongniartii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.30 °C 7.40–19.4

Seasonal swing summer↔winter22.2 °C

Max temp (day)12.3 °C 9.60–24.2

Min temp (night)4.40 °C 3.00–14.8

Precipitation159 mm/mo 76.5–344

Air humidity64.9 % 58.2–66.4

Moisture balance70.0 mm/mo -8.00–263

Vapour deficit490 Pa 428–781

Wind speed2.90 m/s 2.40–4.60

Cloud cover43.2 % 33.6–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)