Baudoinia compniacensis

(Richon) J.A.Scott & Unter. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Capnodiales/Baudoinia

At a glance

Occurrence records49

Data sources8

Biological traits0

DNA specimens0

eDNA detections9

Sources8 archives

Databases and archives Baudoinia compniacensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.02 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF49 records

Environmental DNA5 datasets · 1 countries9 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT22 Mbp

01Narrative

Baudoinia compniacensis is a sac fungus which has been observed on a variety of substrates in the vicinity of distilleries, spirits maturation facilities, bonded warehouses, and bakeries. The fungus is a habitat colonist with a preference for airborne alcohol, earning it the nickname whiskey fungus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Baudoinia compniacensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKT186468.1 ↗479 bp

ACGT

GGATCATTACCGAGCAAGGGCTTCCGGGCCCGACCTCCAACCCATTTGTAACCCGACCATGTTGCCTCGGGGGTGACCCGGCCCGCTCAG …

Baudoinia compniacensis strain UAMH 10808 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Baudoinia compniacensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size21 880 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Baudoinia compniacensis0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type49 records

Wild obs. + sensor47

Museum / vouchered2

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 19≤1 km 2≤10 km 2>10 km 1

24 georeferenced · 23 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ILLSlocation not on record	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Baudoinia compniacensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys5

Countries1

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH7.90 4.40–9.30

Conductivity321 µS/cm 49.0–6,120

Organic carbon0.49 % 0.201–4.79

Water content27.1 %

Nitrate-N22.0 mg/kg 2.00–36.0

Phosphorus6.50 mg/kg 5.00–14.0

Clay10.3 % 1.41–14.9

Sand82.5 % 55.2–96.1

Depth0 m 0–0.2

SoilCalcarosolTenosolKandosol

5 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 10.0–13.0

Seasonal swing summer↔winter14.1 °C

Max temp (day)17.9 °C 15.6–19.1

Min temp (night)6.10 °C 4.50–7.20

Precipitation20.8 mm/mo 15.5–41.2

Air humidity52.5 % 51.7–55.5

Moisture balance-58.7 mm/mo -67.0–-27.5

Vapour deficit667 Pa 552–725

Wind speed4.00 m/s 2.90–4.80

Cloud cover9.80 % 8.20–15.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)