Battarreoides diguetii — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Battarreoides

At a glance

Occurrence records157

Data sources7

Biological traits0

DNA specimens4

eDNA detections1

Sources7 archives

Databases and archives Battarreoides diguetii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF157 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Battarreoides là một chi nấm trong họ Agaricaceae. Đây là chi đơn loài, chứa một loài Battarreoides diguetii.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Battarreoides diguetii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP763178.1 ↗682 bpMexico · 1958

ACGT

CATTATTGAATAACTGATGGGCTGTCGCTGGCTCTTGGGAGCATGTGCACGCTTGTCATCTTTAATCTATCCCACTTGTGCACTGTTTGT …

Battarreoides diguetii voucher KM234768 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS328SEF1-alphaRPB2

fungal barcodemarker

08Occurrence & distribution

Record type157 records

Wild obs. + sensor144

Museum / vouchered13

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 73≤1 km 23≤10 km 10>10 km 13

119 georeferenced · 25 without coordinates

Open the mapobservation + sensor144

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 10

10 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Centro de Estudios Superiores del Estado de Sonoralocation not on record	10
Bronx, US	1

2 institutions · 11 of 13 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Battarreoides diguetii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.