Battarrea phalloides

(Dicks.) Pers. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Battarrea

At a glance

Occurrence records2 194

Data sources9

Biological traits0

DNA specimens7

eDNA detections11

Sources9 archives

Databases and archives Battarrea phalloides's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 194 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 194 records

Environmental DNA4 datasets · 5 countries11 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Battarrea phalloides=""Coetzee 1992"/>" nb="nb"/> is an inedible species of mushroom in the family Agaricaceae, and the type species of the genus Battarrea. Known in the vernacular as the scaley-stalked puffball, sandy stiltball, or desert stalked puffball, it has a woody, slender, and shaggy or scaly stem that is typically up to 40 cm in length. Although its general appearance resembles an agaric with stem and gills, atop the stem is a spore sac, consisting of a peridium and a powdery internal gleba. In maturity, the spore sac ruptures to release the spores. Battarrea phalloides is found in dry, sandy locations throughout the world, and has been collected from Africa, Asia, Australia, Europe, North America (primarily in western regions), and South America. There is currently some disagreement in the literature as to whether the European B. stevensii is the same species as B. phalloides.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Battarrea phalloides has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences10

eDNA detections11

Countries9

The DNA barcodea real sequence read deposited for this species

ITSMN450310.1 ↗567 bpIndia · 2019

ACGT

TCTTAAGAGTATGTGCACACTTGTCATCTTTATCCATCCACCTGTGCACCTTTTGTAGTCTTGGAGGTGTTCAACAAGTGTGCATGTTCT …

Battarrea phalloides strain KRMK10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type2 194 records

Wild obs. + sensor2 006

Museum / vouchered177

Other11

Origin

Native12

Range

Area of Occupancy AOO5 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 830≤1 km 194≤10 km 457>10 km 113

1 594 georeferenced · 412 without coordinates

Open the mapobservation + sensor2 006

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 14≤1 km 22≤10 km 41>10 km 5

82 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	35
Bronx, US	20
WU-MYClocation not on record	13
Palmerston, AU	10
Vancouver, CA	5
BDBClocation not on record	5
Centro de Estudios Superiores del Estado de Sonoralocation not on record	5
WTUlocation not on record	5
Kew, GB	4
Staten Island, US	3
JA-CAGPDS-CAMlocation not on record	2
Tartu, EE	2
Copenhagen, DK	2
ILLSlocation not on record	2
CA	2
US	2
Pullman, US	2
BRNUlocation not on record	1
Kensington, AU	1
Wellington, NZ	1
University of Tennessee at Chattanoogalocation not on record	1
IMBIVlocation not on record	1
Brisbane, AU	1
Chicago, US	1
GJOlocation not on record	1
Mérida, ES	1
Auckland, NZ	1
Universidade Federal do Rio Grande do Nortelocation not on record	1
Berlin, DE	1
Université de Montréal Biodiversity Centrelocation not on record	1
Laramie, US	1
Göteborg, SE	1
Oregon State University, Herbariumlocation not on record	1
MAlocation not on record	1
San Sebastián, ES	1
TENN-Flocation not on record	1

36 institutions · 138 of 177 vouchered records shown · 38 without an institution code

09Environmental DNA11 detections

Where the DNA of Battarrea phalloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys4

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map5 countries0

Developed

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH8.30 4.90–8.90

Conductivity134 µS/cm 36.0–138

Organic carbon0.85 % 0.48–2.31

Nitrate-N18.0 mg/kg 8.00–20.0

Phosphorus10.0 mg/kg 5.00–43.0

Clay11.7 % 9.21–14.1

Sand82.5 % 79.1–85.8

Depth0.2 m 0–0.2

SoilCalcarosolTenosol

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 7.90–28.9

Seasonal swing summer↔winter18.1 °C

Max temp (day)25.8 °C 10.3–34.7

Min temp (night)13.9 °C 5.10–22.5

Precipitation34.0 mm/mo 17.7–117

Air humidity54.2 % 43.1–63.2

Moisture balance-101 mm/mo -218–19.5

Vapour deficit984 Pa 417–2,271

Wind speed4.40 m/s 2.80–5.20

Cloud cover32.7 % 22.5–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Battarrea phalloides

At a glance

Sources9 archives

At a glance

Record type2 194 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 194 records