Balmea stormiae

Martínez · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Balmea

At a glance

Occurrence records96

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Balmea stormiae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility96 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF96 records

DNA & barcodingNCBIsequences

01Narrative

Balmea is a monospecific genus of flowering plants in the family Rubiaceae containing the single species Balmea stormiae. It is native to El Salvador, Guatemala and Mexico (Nayarit, Jalisco, Colima, Guerrero, Michoacán, Chiapas).Davidse, G., M. Sousa Sánchez, S. Knapp & F. Chiang Cabrera. 2012. Rubiaceae a Verbenaceae. 4(2): i–xvi, 1–533. In G. Davidse, M. Sousa Sánchez, S. Knapp & F. Chiang Cabrera (eds.) Flora Mesoamericana Missouri Botanical Garden Press, St. Louis. It is locally known as ayuque.Fosberg, F. R. (1974). Studies in American Rubiaceae 2. Ayuque, Balmea stormae, an endangered Mexican species. Sida: Contributions to Botany, 268-270. It is conical in shape and used as a Christmas tree in parts of Mexico. Because populations are depleted by this overharvest, this species is threatened with extinction.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formepiphyte

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Balmea stormiae has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSGQ852108.1 ↗613 bp

ACGT

TCGAATCCTGCGAAGCAGACGACCGCGAACTCGTGTAACTCTCGGGCCCCCCGGAGAACGGTCGGGTGGGCAATCTTTGCCTCCCTCCGT …

Balmea stormae internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type96 records

Wild obs. + sensor2

Museum / vouchered94

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 47≤1 km 1≤10 km 4

52 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	26
Saint Louis, US	17
Mexico City, MX	11
Autlán de Navarro, MX	7
Austin, US	7
Tuxtla Gutiérrez, MX	5
San Francisco, US	4
Kew, GB	4
Austin, US	3
Chicago, US	2
MEXUlocation not on record	2
Mexico City, MX	1
Giardini Botanici Hanburylocation not on record	1

13 institutions · 90 of 94 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)